Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPN14
Systematic Name YGL004C
Strain S288c
Description Proteasome-interacting protein involved in the assembly of the base subcomplex of the 19S proteasome regulatory particle (RP); null mutants accumulate ubiquitinated Gcn4p and display decreased 26S proteasome stability; interacts with Rpt5p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPN14 YGL004C
AACGTCGTCCATGTTTACGAAGGAACGTCGAAATCTCCAATCTTGACGTTTGACGAACAT
AAGGCTGCTGTTAAGGCAATGGCCTGGTCTCCTCATAAACGAGGTGTGCTAGCTACCGGT
GGTGGTACAGCAGATAGAAGACTAAAAATCTGGAACGTTAATACGTCAATAAAGATGAGT
GATATAGATAGCGGCTCTCAAATATGTAATATGGTATGGTCAAAGAATACTAACGAGCTT
GTGACATCACATGGTTACTCAAAATATAACTTAACCTTGTGGGACTGTAACTCTATGGAT
CCAATTGCAATTCTGAAAGGTCATAGTTTCAGGGTTCTGCATTTAACGTTATCCAATGAT
GGAACCACGGTGGTTTCTGGGGCTGGAGATGAAACATTGCGATATTGGAAACTTTTTGAT
AAACCAAAAGCGAAGGTACAGCCAAATTCGTTAATATTTGACGCATTTAATCAAATACGT
TAGTAAAGGGTTTTCATAGTAGTAATATCATCTCAAAAATTCTGTAAAAAAAAGTGTACT
AGTATATCTGATGGTGTTGTTGCGAATGCCCAGTAGTTCATATAGTTCTACTTACACCTC
ACTCATCTAACAAGGTCGGTTGATTAGTTCAATTGTTTCAGTGAGAAGATTTTAACGATA
ACACTTATGTACTAAGGTAACGTACCTACCAAGCATACAAAATACGTAACAATATAAAAA
GAGACGGTTAATAAGTTCCGTTAAAATTTCGTCATCCAGTTATTAGAAAACTGGATGGAA
CCTTTTTCTTGCACATTAAAAATGGCATTTGTCCTTGTCAGGATTTGGGAATAAGGCTCA
GTTAACCTTATTAACTTTTGTGATGTTTTTAACATGACATATTACAGGCGTCAGGATGGG
CGAATAATCTAGAAATCGGCAAAAGAAGCTTCGAAAAATTAAGTTTTCAACCCTAAGAGC
AGAAAGTAAAAAGAAATAGCGAAGTACAATAGAAACGACA
Chr coordinates Chr VII from 491956-490703
w3c xhtml validator w3c css validator