Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BRP1
Systematic Name YGL007W
Strain S288c
Description Dubious ORF located in the upstream region of PMA1, deletion leads to polyamine resistance due to downregulation of PMA1
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGL007W	6321431 upstream sequence, from -1000 to -1, size 1000
GCAGCCAAAATAGCAGCGGCTTCCATAACGAATTGAATTGGACCGACGAAAAACATAACG
AACTTAACGACTAAAGATTCTTTTTCGTCAGCCATTTGATTCAAACCGTACTTCTTTCTT
CTTTTCAAAACTTCATCGGAAGTTAAACCGTAAGATGGGTCAGTTTGTAAATATTCTTCT
GGAACTGGTCTAGCTTCACCGGCGGCAACTGGACCATCGTTATCACTGTCTTCGTCGTCG
ACACCGTGATTAGATTGTAGTTCTTCGATTAAAGCATCGATATCGTCATCGTCAGAAGAT
TCAGATGCAGCGTCATCGTAAGTCTTAGCAGGCTTTTCTTGAGTTGGCTGATGAGCTGAA
ACAGAAGATGCTGAAGAGGATGATGAAGAGGATGATGTATCAGTCATATTGATATTGTTT
GATAATTAAATCTTTCTTATCTTCTTATTCTTTTCAATGATTTTCTTTAACTAGCTGGGG
TATATTTTTTTTCTTTCTTTTGAATGTGTGTATAAAAGAGAGAAAAAATGGTTATTTTCC
AATTAATTAATTATTAACGATTGTTAAAGAAAAAATTTATCAACGAGGTTGATAGAAAAA
AAAAGTTTTTGTAGATATAGAAGAAAAAAAGATTTTCACTATTGGTGTTATAGGAAAGAA
AGAGAAAAAATTTAAGAGAAATTAGATGTTAGACGATAATGATAGGACATTTGAAAATAA
TACAATATTTGGCCTTTTTATATAATCGAAACTAATGGAGGGGAGCATAAGCGGTACCCA
CCATCGACCACGTTTCGTCACCGGTCATAATTGGAATAAACAAAACAAACAAACGAACTA
AAGAGTGTGAGAGTAACAATTTCCACAGAGGTAAAAAAAAAAAAAAGGAAAACAGAAACA
AAAAAAGCTCATAGTTCTACTATAGCTTCTTCAGACTTTCTGTGAACGAGGGAAAAAGAC
AACAAAAAAGCAATGGATAAACGGTCTCGAGAGATTTTTC
Chr coordinates
w3c xhtml validator w3c css validator