Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGL015C
Systematic Name YGL015C
Strain S288c
Description Putative protein of unknown function; null mutants accumulate cargo in the Golgi
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGL015C YGL015C
CATTAAAATCAGGGGGCGGAAAAAATGGACAAGGATTATGAGGAACCTGCATCATTTGAG
AGTAGGGCATGAAGCCCATTCCACCCATCATTTGTGGATGTGGAAACATTTGCGACGGAG
GGCCATTAGCGAATTGAGAATCTTGAGAAACTTTATTCGCAAATGCATTAGAGGTGGCGT
TTTCCTCTGGATCATCTAGTTGCAACTGCTCTAAAGCAGAATTGACTGTTTCTGAAACGA
CAGGGTCTACTGATGGTACATCATCGATTTCTTCTTTCAAACCTTTTGTAGACATAACGT
AGGTCCACTTAAAAATGTTACAGCGCTTAGTTCTCTCTTTCTTAAAAGATATCGAGGACA
AAGAAACAGTAAGAACGGAAAATGAACAGAGACTCTTAAAAGAACCTAAAGAATAAGCGA
AAATAAAATATGAAAAGAGAACTAGTGGACAATATCAACAGGAATTTTAAGTGTACTAAA
AATAAATCGTCTGGAATAGTGTACAAAAACGAATAATATTAATGACGGCTCAAATCCTAA
CGTTGGAAACTAAAATACAATAAAAATAATGTACAATGTAATATACGGAAGAAAGTTTTT
TTTCTGTTTCAACAAAAAAAAAAACTATTCAAAAAAAAGACGTGAGGTACTGTTTGCTGT
TCACCTTCGGAGAGAGATAACCAACCGATATTCTCTTTGAGTCTGAGTGATTTGTTAAAC
AAGGTGCAACGAATAAGAATATAACTATACTATCTACTATATTGATCATTATTTTTTATT
CTCTGGAGGACCCCAGAACAAAAAAAATATAGAAAAAAAACAATCGTCAAGAGTGACAAA
TACATGAGTAATAAGAAAAGGCGTCACAAATTAAAATTTGCAGTCACAAAGAGAAATAGA
CAGAGAATAGACTGTCTGGAATTAAGATGTCTTTTCTATCTGAGCTCCCAACAAGGCAAC
GGTATTGGACAGATATAATTCACAAATCACAATTCACTCC
Chr coordinates Chr VII from 465435-465043
w3c xhtml validator w3c css validator