Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TRP5
Systematic Name YGL026C
Strain S288c
Description Tryptophan synthase, catalyzes the last step of tryptophan biosynthesis; regulated by the general control system of amino acid biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TRP5 YGL026C
CAACCACTCTGCGGCCGCTTCGACACCCACCACAACTGCCACCCCTCATGCAAATCCCAT
CACACATGCGCACTCGCTTTCGAATCCAAATAGCACCGCTACAATGCAACATAATCCCCT
GGCCGGCAAGAGAGGTCCAAAAAGCGGTAGTACTATGGGAACTCCAACCGTACATAATAG
CACTGCAGCTGCACCGATTGCGGCACCTAAAAAGCCAAGAAAACCAAGACAAACCAAGAA
GGCAAAGGCTCAAGCTCAGGCTCAAGCGCAGGCTCAAGCGCAGGTCTACGCACAGCAGTC
GACTGTCCAGACGCCAATAACAGCATCGATGGCAGCCGCGCTACCCAACCCAACTCCTAG
CATGATTAACAGCGTTTCGCCCACAAATGTTATGGGCACGCCGCTGACCAACATGATGTC
TCCCATGGGGAACGCATACTCAATGGGAGCTCAAAACCAAGGGGGACAAGTATCTATGTC
ACAATTCAATGGCAGCGGCAATGGATCCAATCCAAATACAAATACAAACTCCAATAACAC
CCCGCTACAGTCACAATTAAACCTAAACAATCTAACCCCTGCTAATATCCTAAATATGAG
CATGAATAACGATTTCCAGCAGCAGCAGCAACAGCAACAGCAGCAGCAGCAGCCTCAACC
ACAGTACAATATGAATATGGGCATGAATAACATGAATAACGGGGGGAAAGAACTGGATTC
TCTAGACCTGAACAATCTGGAATTAGGTGGTCTGAACATGGATTTCTTGTGACTGGTGCA
TCTATGTATCCAAGATAGTAATTATCTGTATAATCTTCTATTCTTTATACCTTATTACCC
GAAAGGCTTTTCTTTTTATTTTTTATTTTTTTTCACTTCTTGACCGTGGAAGAATGACTA
ATTTTACTATTTGTCATATAAGAATCATCGAGATTCTTACACTTTTTATGGACTGTAAAC
ATCGATTGCTCCAAAAAGGGACATAGCACACCGACAGACC
Chr coordinates Chr VII from 448535-446412
w3c xhtml validator w3c css validator