Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SCW11
Systematic Name YGL028C
Strain S288c
Description Cell wall protein with similarity to glucanases; may play a role in conjugation during mating based on its regulation by Ste12p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SCW11 YGL028C
CCCAATTTGGATGAATATTAATTACTTGTGTCTTGACGCAATGAGATACTACTACCCAGA
GGTGATTCTCGACGTGGCTGGTGAGGCTAGCAATGCCAAGAAACTGTACCAAAGTTTAAA
GATTAATCTCAGTAACAACATATACAAAGTTTGGGAAGAACAAGGTTATTGTTATGAAAA
TTACAGTCCGATAGATGGTCATGGTACTGGTGCTGAGCATTTCACAGGCTGGACAGCACT
TGTTGTCAACATCCTTGGACGCTTCTGAATCTATGTAGATATTTTCAGTCATATAAACAG
ATATGTAACCAGATATGTACCAGTATGCAGGATGAAAATTATAAATGTTCCAGCTATTCG
AAAAGGGCCTCGCATCTCTTAGTTAGAGCCAGCATTTTCAGCTTTTTTTTTCTCGCGTTT
ATTTACATTTCGATGCGGCTGTGAGAAAAAGTTAAAAAATCGTGGAAACCAGCAACTGGT
AACTAGCAGTCTGGGCCATTGCAGCTAAAAGCCAGACAAATAAACAATCGAAAACACACT
CGAAACATGCATTATGAAATGTCACATTTTTTTTTTTCTTTTGGGGATTAATGGTTGCGA
AGTGAGGTCTTTTCTATTTACTGCGGTAAGATGAATAAAAGTTAGGGAATGTTATTGTTT
ACAAGCTGGATACTAGATCTCAAAATGTTAAAGTGTAAGGACTGACAACAAAATATGCTG
CACCGAAAACAAATTAAGAATCTGAGGAGGGACTATTTAAGTGGAAAGAAAATTGAAGTT
CAATGATCGTGTTTTCCTTCTGCTTATCCAAATACACTGTTATATATTAAGGCAACAGTA
CTATAATCGTCAGTTACGCAACAAAGACAGTCCACTCTTTTAGAAGAATAAGCCTTTACT
GACATACCTCCACTGTAATAAATCTATTCTATTCTCTGTACTGTTTATCGACTTATTATT
ACGCTACACTCATTGATATAATATCTAATAGAAAACCATC
Chr coordinates Chr VII from 442909-441281
w3c xhtml validator w3c css validator