Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AGA2
Systematic Name YGL032C
Strain S288c
Description Adhesion subunit of a-agglutinin of a-cells, C-terminal sequence acts as a ligand for alpha-agglutinin (Sag1p) during agglutination, modified with O-linked oligomannosyl chains, linked to anchorage subunit Aga1p via two disulfide bonds
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AGA2 YGL032C
CAAATCTGCCTCTTTGTTCAAGCAAAGAAAGAACCCAAGAAGAATCGCTTGGACTGTCTT
ATTCAGAAAGCATCACAAGAAGGGTATCACCGAAGAAGTTGCTAAGAAGAGATCTAGAAA
AACCGTTAAGGCCCAAAGACCAATTACCGGTGCTTCTTTGGACTTGATCAAGGAAAGAAG
ATCTTTGAAGCCAGAAGTTAGAAAGGCTAACAGAGAAGAAAAATTGAAGGCCAACAAAGA
AAAGAAGAAGGCTGAAAAGGCTGCTAGAAAGGCTGAAAAGGCTAAGTCTGCTGGTACTCA
AAGTTCTAAGTTCTCCAAGCAACAAGCTAAGGGTGCTTTCCAAAAGGTTGCTGCTACTTC
TCGTTAAGATTTATGCTCGAACTTATTATGTACAATGAATATTTTTCTTTTAAATCATTT
TTAAATATTTCAATTTAGTATTATTTTCTGTATAATTCATTCGCGAGGTATAATCTACCA
TCCACTTCTCTATCATTATACTCCCATATTTTTTTATTCACAGGCTAGACAATGGTAATG
GTGCTTTAGATGATTTCAGTGGATTACATTCGCACAATAGAATAAATGACTAATTTTCAA
GAATTTGTTTCAACCTGCCGGCATTCAGTTATTATAAGTTATTGTTTGATGGTAAAACTT
CGCCATCACCGGTTGCTGCGTTTATTGCAAAATTACTGAAACCATGTAATTTCCGAATAC
GGTAATTACACGCAGTTTGAAATTTGACATGCAAGTTTAACAAAAAAACTTCTGTCCGCA
TCTAAAGCTTAATTAAGGGACTGTTTCATACCTTCAGATCCAATATACTGAATATCAGGC
AATTGATTTCCCTTGTAAATATACAATATAAATAGTTGTAAGAAGAGGTGATATGTTAAG
TTTCCATTTTGACGTATTCCTCATTCTAGAATGATTGTAAGCTCTCAACAGTCACTTGTG
TGCCAAAATATTATACCTACTTCATACATTTTCAATTAAG
Chr coordinates Chr VII from 436833-436570
w3c xhtml validator w3c css validator