Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HOP2
Systematic Name YGL033W
Strain S288c
Description Meiosis-specific protein that localizes to chromosomes, preventing synapsis between nonhomologous chromosomes and ensuring synapsis between homologs; complexes with Mnd1p to promote homolog pairing and meiotic double-strand break repair
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HOP2 YGL033W
CAAAAAATGTATACAAACTCTTAGGATTGGTCAAGAAAAGTAAATGTTGTACTGCTCCAA
AGATATTGCGATGCCGTGATAATTCAAAAGGGTCGACCCAGTCTATTTCACTCGCGCGAT
AATCGTTCGTTATCCGAAGCTGGCCAATTGATACAATTAATTGACATCAGCAGACAGCAA
ATGCACTTGATATACGCAGCTTAAAGCAAGGGTAAATTATCTGAAAAAGGATTGAATACA
ATCAAAACCTTCACATACATTGGTAGTAATATCGAGCATCGCTATTAGCAGAGTATCTCG
AAGTCTACCACGGCGAAAGTTGATTTTTTATCTGAGGTGCTGATCTTCGGACGCAATGCG
CAAACGTAATTCCGTAGTTTTCCCAATTATTTTATTTTTTAAATTACACGTACCAGGTAG
ATCACATACATATACCCAACACCTGTTATATAGTGAATTGAATTATTCGGAACATCAATA
ATCCTTTGCTTATAATTCTTGTTATCATCCATCTTGCATCTTTATTTAATTATATTTTGC
ACAATAAGCTATCTATGTGAGCTGCGTACGGTGACTCCAAACAATCTGTTAATTTCCATA
TAAATAACTTGTAGTCGGATCGTACAATGGCTCTATATAGGTTTGGACCGGTATGTAACC
TAATATGGCTGACTCAAAACCTGCTAGATAGTTATCCAAGTGAATTTGAGTCTCGTATCC
TTTATCACATTTTTACAATAGTGGCTAGCTATCTTTTTCATGTTAGGCTCACCCGGTATT
CTCATGCAAGATCAAACAAAAAATGGTAAAGTTTTGGACTTTACATTGCTTACAGTTGCT
TTTTTATGAAGATTCAAAAGATTATGTCCTCGGCGGCTAAATTTTCCATTAATAATATTA
TCCTTTTACGCGACCGAAAAAGAGAAGCGTTTTAAGAGTTGTTTCTAACAAATATTAATA
ATAAAGCTAACGTGAACTGACCAGGCTCTATTTGAAAGAT
Chr coordinates Chr VII from 435625-435679,435750-436312,436375-436401
w3c xhtml validator w3c css validator