Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPT6
Systematic Name YGL048C
Alias CIM3, CRL3, SCB68, SUG1
Strain S288c
Description One of six ATPases of the 19S regulatory particle of the 26S proteasome involved in the degradation of ubiquitinated substrates; bound by ubiquitin-protein ligases Ubr1p and Ufd4p; localized mainly to the nucleus throughout the cell cycle
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPT6 YGL048C
TTTTTTTCTGATCAAAAACGTCTAAGGCATTACGCGGATACTGCTAACTAACCAAAGAAA
CCTTCCATCTTTTTTTTTGGTAGTTGTCCTACTTTCCGTTCTTTTCGTCTTTTAAAATCT
TACTAACTAGCTGTATATAGTTTCAACTAGCAATCGCTCAAATGACGGGTTATGAGAAAC
TGGGAATGGTTTGAGTTTCTCTGTTTGAGATGCACGTAAACCAGCTATCAAACCTGTTTC
AGTGGGTGCACAAGACCATACGTAGCCCAACTCTACAAACTTGTCTGCTATCTGCTGCTG
GTGGTTATCCATCAAAGAATCGTTTACGCAAACTATCAACGGTTTATTCAACCGTAGAGA
ATCTAGTATAGAGCCCGTTCCAGCGTGTGATATGACCAAATCTGAATAATCACGTATAAT
ACTTTGCATCTTGGTCGAAAAGTCAAACCCGATCACCTTTAATTTCCCGTTCATCAGGAC
ATACTGTCTTGCGGTGTCGCCACAGCCAAACTGGTCAATTGGAATTTTTTGGCTTTCTCT
TTGGCCCCCGCGTTCTTGCACTAAATGCTCAAATTCAGAACTGTAGTTTCTCCCAAACTG
AATGATTAGACGTACGAATCCATATTGAATCAATTCTTGGCAGAATTCGTCGCTTAGCAC
ACATGAGACGAGCTTTGGAAATGGCACCGTTGCCCCACACGTAACAAAAAGAGCCTTTTC
TTCAATAATACCCATTGTTTGAAAGAGCTGGCTTCTGACTCGTTTGTTTAACCTCTTTTT
GCGACTGAAAACTTGTTTTTCTATTTCCCTTTTTCTTCGGTTGGGTTTTTTAATATGAAA
TCATATTTTGCATACTTCTCTACCCTTATTCTTGTTCGGAAATTTTCGTATTTTAAAACT
GTCAAAATGCGAGCGAGGTGGCAAAAGTTGTAATATCAGTAACAGTTAGGTTAGGTTTTA
TGTAAACGGAACAACAGTATAGTGGGATACTATCACGACA
Chr coordinates Chr VII from 411286-410069
w3c xhtml validator w3c css validator