Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MF(ALPHA)2
Systematic Name YGL089C
Strain S288c
Description Mating pheromone alpha-factor, made by alpha cells; interacts with mating type a cells to induce cell cycle arrest and other responses leading to mating; also encoded by MF(ALPHA)1, which is more highly expressed than MF(ALPHA)2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MF(ALPHA)2 YGL089C
GACAGAAAGACTGTTGCACCCAAGATCGATAAATTTGTTCTCCAGTCCAAGCCAATAATA
AATATATTGCAACACCAATCCACATTCTTCATGGGTCAAGAACGCCCCGGAGGGGTTCAA
CCTCGACGAGATACTGTACGTGTTACGAATGGCTGTTAAATTTGCGTTACTGTTATAAAA
TAACACTAAAATAAGAAATGGAAAGTAAATAAATAGTAAAGGAAAGTCAAATAAAGCAAT
GAATGCTGCATTGATCTGCCTTTTATAGCTAAGAAAAAAAAAGAGAAAAAAATAATAAGT
GCGGGTAACCTCATGCATTGTAAAACGGTAGGGCTACAAGGCACTACTTACTCTACGCTA
TAGAAGAAGCTTCAAGACATGGTGTTGTTCTTATTTGAGCGAACTCAGCTGTCACCGTTT
CGGGAAACTCTATAGTTTTCTGCGTTTCAGTACGCAGTTGGGCGTGCTAAAGTTGTTTTC
CTAATTTGCTAGTGTTCACTTGCTCATTGATGTCCCTAAAAGGTAATGTCGCATAGTAAG
ATGTATGTCCCATATCAAACGCATTCCTAGAAAAACATGCACTGAATGAATAAGCAGTTA
CTTCGATTACTAATCTTCACAGCATAATTTTTCTCTTATCTTGTAAACCTCTTTCTATCT
TTTCATAAAGTTTGTCACTTATATTTCTTCATTGGTACATCAATGCCAGCAACGATGTGC
GCATCTGGGCGACGCCTGTAGTGATTGTTTTCAAGGTATCGAGCCAAACTATTCATCGTT
ACTGTTTCAAATATTCAGTTGTTTCAGTACAGAGTCGCCGTGGACCTAGTGAAACTTGGT
GTCTTTACAGCGCAGAGACGAGGGCTTATATGTATAAAAGCTGTCCTTGATTCTGGTGTA
GTTTGAGGTGTCCTTCCTATATCTGTTTTTATATTCTATATAATGGATAATTACTACCAT
CACCTGCATCAAATTCCAGTAAATTCACATATTGGAGAAA
Chr coordinates Chr VII from 345153-344791
w3c xhtml validator w3c css validator