Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPS5
Systematic Name YGL259W
Strain S288c
Description Protein with similarity to GPI-anchored aspartic proteases such as Yap1p and Yap3p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPS5 YGL259W
TGTAGATATATGTGCAGATGACATGAAGTATCCAGCTCTTTTGTGAATATGGAAGCAAGT
TTCTTTCAAATTATTATCGACTTTTCCTCTGCCCCTTTTACCTTATAACTTTAGGAAACA
CTACCCTATTCATACTCAACTAAAAAAGTAGTACGTTTTCTTCTTTGAGAGGTATGGTGC
AAACCAGTGCAATCTGATTCCAGATTGCCCTCACGTGAGGCTTCAGTAAATCTCGATCCC
TCTACATATTATATTATCTCCTACTTGGCAAAATAGATGTGGCTTTAGTTGATGAAAATT
TACCACGTCAACTATTTATGTCCTTTCTACAATAAACCCCGACCTACTATCCTCTATGTT
GTTTTTAACATACCATACGAGCGTCATATGTCTTTTGGTTCACTGGGGAAGACCATCACT
GTTGAACGTTTGTTGAAAAGTTCGAGATGATGAAGATTGCATAACAAAATGTAAAGTTAT
ATTTAGAAACTATAACGGTTCAAGACATTCAACACTATAACATAGCTTGGCTGGCTTGAA
CAAAAAGAGGAAGAAGCAAAAGCAAGAGTAAAAAGCTTCTCATATATTTCTGGCATTGTT
GATCACCCAGTGCAAGCCCAATTTCGCCTGTGCTTTTCTTAAATTGTTTCTGACAACACC
GAGGTTTTCGCTGCAGAAAAGGACATATGGTGGTAATTTGTATAAGGGGTTAAGGGTCCA
AAAATTTGCTACCCTATCGCTCACTATAGCAAAATATCTCGAGAGATATCCGAGGAGTTA
AAACTGACTAGACCTGTTGCGTAAACCTCATGCAAGCAGTACTCTTCGAGGATTTAAGCT
TTGGAACTGCTTTCAAAGTTGAGAGTATATAAGGTGTTATGATCTTGGAATAAGGTTTTT
CATCGTTCTTCCTTGTTCTCTATTTTCATTGGTTGATCAGTTGTTAAATTTTGTCTCTTT
CGAAAATAAGGATATTTGAAGACAACGCAACGCTATCAAT
Chr coordinates Chr VII from 8470-8967
w3c xhtml validator w3c css validator