Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CUL3
Systematic Name YGR003W
Alias CULB, CULLIN B
Strain S288c
Description Ubiquitin-protein ligase, forms a complex with Elc1p that polyubiquitylates monoubiquitylated RNA polymerase II to trigger its proteolysis; cullin family member with similarity to Cdc53p and human CUL3
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CUL3 YGR003W
CTACGAGTGCCTCTTCTTCAGCAATTTCTGCTGCAGAACGAGAAAGAAGACGCTGTAAAT
ACTTTTTTCTCTCTATCTCCTTTTCAGCTGAAAAATTCAAAGAAGATAAAAGCGGATTGC
TAGGATCACTTGCTTTAAAATAATTCCTACAGGTGTAATAAAATTTTTCTTTGAGATCTT
CAAGTGTTCTTGAATTATTATAACTGTATCTGTCAAAGATCAGGAACCAACGTAAATCGT
ATTTTTTGCAGAGATTGAACAGGTATTCTATTTCTTCAAAAGACCAGCTATTTTTACTTT
CATCCTTCTTTTCATTAGTAAAGTTTTCGTTATGGTTTTTTTCACTTTCTACGCTTTTTT
GAGTTCCTTCGTTTTCATTCATAAAAGCCTCGTACTCCTCCTTGGTGAATGATGGAATAG
ATAAATGCTGATTGAACTTAGAATATGGCGATTCTTTTGGTGTGTCTCCTATTAATTCTT
TGGAACCCTTGACCCAATGACGCAGAGTCACAGAGTTATTAGCTTTGAACTCTACAAATG
ACCAAGGAGATGGCTTGGACGTCGAAAGCATTTTTTCTTTAAAGTTATTTCCAGACTTAA
TAACAACGGGGGGTTGGTTCTCTCCTAGCAGGTTAAATAGTTCTCTTTGCATGCCCGTCA
CTTGAGGCTTGGGCCGGTTGGCTGCCGAGGACGAAGGCACTGATACCTGGCCATTAGTTG
GACTTCTGGATTTTTGCTTAATGTTTAGTACATCAAAGATGTCTGATGATGACATATTAC
CTGTGGTTTTTTTACTAAATTTTCGTATTATCGGAGAAATATGTTATGAATGCTTGTTGC
TATTAAAATACAAAGTGGATTCTTGATTTATCACTAAATAGCTACCCGGAGTTGGCGCAT
CGCAACTTCATTAAATAAGTTCGAGTGTGCGTATTCTAATCTGATTCATATAAAGTATAC
TCTAAACGGGCTAACTCAAATCTGAAATTAGGGCTACTAT
Chr coordinates Chr VII from 500132-502366
w3c xhtml validator w3c css validator