Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PEX31
Systematic Name YGR004W
Strain S288c
Description Peroxisomal integral membrane protein; involved in negative regulation of peroxisome size; partially functionally redundant with Pex30p and Pex32p; probably acts at a step downstream of steps mediated by Pex28p and Pex29p; PEX31 has a paralog, PEX30, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX31 YGR004W
GATGACGTTAAGTCTCTTGTAATGTCAATGTCGACAATACCCAGATGTAAGATTTTGAAA
AAATCATCCAGTTCAGGAAATATGAAATTTTCAGTTAATTATTTCTTTTCTTCTCCAAAC
AGGAAAGTGAAAGTGCCGGTTATTGCATGCCCTCTACCATCTCAGAAATCAGATAATTTG
GCAACCGCAAGTTCCGTGGACACTTATGATAATGAAATTGTTATGGAGCTTAGTGCTATT
ATTGTTCGTATCATGAAAACAGAAGGTAAGCTAAGCCATCAGCAATTACTTGAAAGAACT
ACGAAACGGACACAGTCTCGGCTCAGTCTTACACCGAGCATTTTGAAACGAAGCATTCAG
CTTTTAATAGAGAAAGAATACATCCAGAGAAACGCAGATGACCCCTCTTATTACCATTAC
CTTTCCTAATTGCTTATAATGAAAATCACAGGTATAAGGTTTGCAGAATGCCAACAGTAT
ATATAGATGGCAGTTCCTATCCGGCTGCCAGAGCGAACAATATTAAGAGGATATGCGTCG
ATACTAATTGAATGTTCATCCTGCATTCCTTAGTGAAACTTTCAAAATATATAATAACAT
AGTTATGGTAGACTATATATCCCAGTCAAACTTGAATGTAATGTGGAGTGGGTAATCGAT
ATCTCTTGAAGTTTATTATGCCTCATTATATTTTTATAAAAAACTTCTAGGAATTTGTTG
AGTCAAATAATTTCTTTCTTAATCATTAAGTAAGTTAAAGTTACGAGCCTTTCAGACCTG
CGTAGCACTGCTTCAAAGGAACTATTATCAATAGCAGCGCCTTGCTCTTTTTTTTTTTTC
AGATGCTTAGCGGCCGTATTTCACTTTTCCTGGTAGAAAAATATATGTTGAAATTTACGG
TATAAGAGAAGCTCACCAAAATTATTATCAATAAAGCGGCACTTTTAAATTTGGTATTCT
TCCCTGGTTGTCAAGCCTTGGTTTCCCTTTATTTGATAGT
Chr coordinates Chr VII from 502938-504326
w3c xhtml validator w3c css validator