Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name STF2
Systematic Name YGR008C
Strain S288c
Description Protein involved in resistance to desiccation stress; Stf2p exhibits antioxidant properties, and its overexpression prevents ROS accumulation and apoptosis; binds to F0 sector of mitochondrial F1F0 ATPase in vitro and may modulate the inhibitory action of Inh1p and Stf1p; protein abundance increases in response to DNA replication stress; STF2 has a paralog, TMA10, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>STF2 YGR008C
ACTCAAAGAATAGAGGGTGCTATGAACGCAAATAATAACATAAGTGAGGTGCGGGAAAGA
TATCAGAGGAAGAATGTTCTAGAAAAGGCAAAGAGATATCAGTTTGAGAATGATGAAGAA
GATGACGAAATGGAATTGGAAATTGATAGGAATTTGGACCAGATTCAGCAGGTTAGCAAC
AGATTGAAGAAAATGGCCTTGACCACTGGTAAAGAATTAGACTCTCAGCAAAAACGTCTC
AACAACATTGAGGAAAGCACTGATGATCTAGATATCAATCTCCATATGAATACCAACAGG
TTGGCAGGTATCAGATAGAATATGCCTGTAAAAACTATGTAATATATCACAAGTAACAAC
ATTTCATCACCATTACTACCATTATGTAGAAATTTATGAGCAAAGACAAATAAGTAAAGA
AAAAGACATTGATATAATATAAGAGTATGCTTTCTTCATTTTAATGTTTGGTTGTGAATT
GAAAGAATACCATTCGGGCACGCAATAGTTATGAACTTAACCGAGCTCAAATAATTTAAA
GATAAAAGATAAAAGATAAAAGATAAAAGACAAAAGAAAATTCATAGCCCATGTTGAAGT
ATCCCAGCGGGAAATGTTGCTATCCAACAGAAAGTACCAAGCCAGTTTCAAAAAGGTACA
GAATTAAGTGATGCTATCCGTCCCACAACTAATTTTCTCCAGCGGAGGAAATATACGCGG
AGGGGGGGAGGAAAACCTCTCAGTAAGCAATGAAGGGATAGATAATGGGGGCGCGCCTGC
CTAGCTTAGGCTAAGAAACTCCTTCGAAAACAGGGGGCTGCGAGCGCAGAAGCGAACACT
TGTCATTTGTATAAAAGGACTATTTATAAGTTTGCTTTTTGTCACTCTCTTGGCCCTAAT
TACCCATACTATTGTAACAATTGTTGTGTAAACTCAATTATACAAATAAACGAACAATCA
ACAGTAACAAACCGCTCAAGTGTACAACCAATCAGAAAAA
Chr coordinates Chr VII from 508364-508110
w3c xhtml validator w3c css validator