Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SNU71
Systematic Name YGR013W
Strain S288c
Description Component of U1 snRNP required for mRNA splicing via spliceosome; yeast specific, no metazoan counterpart
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SNU71 YGR013W
TAGGGCACACATTTCTTTGCCCGATGACACATCGCTAGAAAAATTGGCATTACTAGAAAG
CCTCGGTGCTACTGTTAATAAGGTTAAGCCCGCTAGTATTGTCGATCCAAACCAATACGT
AAATGCCGCCAAAAAGGCATGTAATGAACTAAAGAAGAGTGGTAATGGAATAAGAGCAGT
TTTTGCCGATCAGTTCGAAAACGAAGCCAACTGGAAAGTACATTACCAGACCACAGGCCC
AGAAATTGCCCATCAAACTAAGGGAAATATTGACGCATTCATTGCTGGCTGCGGTACTGG
TGGCACCATAACTGGTGTGGCAAAATTCTTAAAGGAAAGAGCAAAGATACCTTGCCATGT
CGTTCTAGCGGATCCACAAGGATCTGGCTTTTATAATAGAGTCAACTATGGCGTGATGTA
TGACTATGTAGAGAAGGAAGGTACTAGAAGAAGGCATCAAGTTGACACTATCGTAGAAGG
GATTGGGTTAAACAGAATCACTCATAATTTTCATATGGGCGAAAAGTTTATTGATGAATC
AATACGAGTCAACGATAATCAAGCCATTAGAATGGCAAAATACCTATCGGTAAACGACGG
GCTATTCGTGGGGAGTAGTACAGCTATTAATGCGGTAGCCGCTATTCAGGTTGCAAAAAC
GCTTCCTCACGGCTCAAACATTGTGATTATTGCATGCGACAGCGGTTCAAGACACCTAAG
TAAATTCTGGAAAGAAGCTAAAGAAATCGATCACGACGTGTCATTAGAAGAAGTAATAAA
TATCTAACATAGATGTATAAATCAGTACTGAGTTATCTTCTATTAAATTGTAGGAACAAA
TATAAAAAAGCAGTTTTCGCTGCTACATTTTTTGCTACTTTCCGTGGTAATGATGCCCGC
TAAAAAGTGCAAAAGTAATTAGATAGATCAAGAACAAAAACAGACCAGGACCAAAATCAA
GCTCATAAAAGTTCCTTAAGAGTACGTCGATTTACAGAAC
Chr coordinates Chr VII from 514554-516416
w3c xhtml validator w3c css validator