Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UGA1
Systematic Name YGR019W
Strain S288c
Description Gamma-aminobutyrate (GABA) transaminase (4-aminobutyrate aminotransferase) involved in the 4-aminobutyrate and glutamate degradation pathways; required for normal oxidative stress tolerance and nitrogen utilization
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UGA1 YGR019W
TAGATACTCCAATTAACGACGACGACGACGACGATAAAAATAATGACGCCGACAATAATG
ACATTAACGAAGATAACAAACTTATAGAATCCATAGAGAACGATGAACACCATGAGGATG
AAGACGACTACTACCCTCAACCACAAGAATGGGAGGCTGAATTACTAAGACAATGGTCCT
CTCTATCAAGGCATACCAAGTCATTGTATAGGAAGCCAGCCCCGGGCCAGAAACTTACCT
CTGAAACTAGCAAACAACTGGACAAACTCCATAGAGGAGTTGACGGTGCTAAAGAGGACG
CTGGACTGGAAAACTTTGGTATTGTCTGTCTTTGTGTTGATTCTGTTGATTTTTTGAACT
TGAAAGAGGGAAGAGGTGGTGAAAGATGGATTTTCCAGAAAACCGACGGCAAAGACGAAG
ATCTGTGGGAGGAACAAGAAGTGTGTCCGTGAGAAATGTCAATCATTATTGCTAACGTTC
GCGATGGTTAATGCTTTGTATTCGCGCTATCTCGATTTCTACCTATATAGTTAATCTCTG
TACAAAAACAATCTTTCCAACTATCCATTAATCATAGTATATTATCAGCGTCGGCGATTT
TACCACGCTTGACAAAAGCCGCGGGCGGGATTCCTGTGGGTAGTGGCACCGGCAGTTAAT
CTAATCAAAGGCGCTTGAAGGAAGAGATAGATAATAGAACAAAGCAATCGCCGCTTTGGA
CGGCAAATATGTTTATCCATTGGTGCGGTGATTGGATATGATTTGTCTCCAGTAGTATAA
GCAAGCGCCAGATCTGTTTACTGTAAAATTAAGTGAGTAATCTCGCGGGATGTAATGATT
TAAGGGAATCTGGTTCAGGTTTTCACATATATTTGTATATAAGGCCATTTGTAATTTCAA
TAGTTTTAGGATTTTTCCTTCTCCCAAAATACTCACTTACTGTGTTACATTACAGAAAGA
ACAGACAAGAAACCGTCAATAAGAAATATAACTAAGAACA
Chr coordinates Chr VII from 525229-526644
w3c xhtml validator w3c css validator