Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGR026W
Systematic Name YGR026W
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cell periphery
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGR026W YGR026W
ATTATTGTAGTTTATCCCACATTCAGAAAATAGTATTTCCTGTTTCTCATTACTAAATGT
TCCACATAGTTTCTTCTCGGATTCCTGGGGAGTTAAGCCACACTTTATTATTAACTGCCA
AAACGTCGTATTATAAAGATTGTTTATATGTGTATCGACATATCTCCAGGATAAATAATC
TTTTATCGTTTGTAAATTAGGGTATGCTACACACCTTGAATCGAAATATGGCAAATGCTT
GATATTCAACGGCTTTTCTGGGAAAAACTTGGCCCATAATGCGACGTAATTGGACGTGAA
AAAAGAACCAAATAAAGTCGCAAGCTTGTCTTTCCTTCTGTTAAATAAAGTTGTACTTGA
CTTCAAAATAAATGAGTATTCGTCACTCTCCCCGAACGCCAATATAATATCATTTTTGTA
CTTGAGGACAAGGTTCTTAGCACATGCATTCATTAACTTCAAAGCATTTTCATCGTTTGG
CTTGGCAAACTCGTAGAACTTGGAAAATTCATGAAACTTCTTGCCGTCTATTCTTACCAC
AATATAACACTGAGGCAAAATAACATCGTGTGTTTCAAATTGCCTTACGTATCCAAATTT
AGAGTTTGCCATCCCGCTCGCATTAGGAAGTAGAATCTTTGAACATTAAGGCACATGACT
GGCTATGAGCCCTTTAAGTTTTTCTCTATCCGCATGTCTTCAATTAATTCTCCATCAGTG
ATTTTTAAAACAATAAAAACTTTCAATCCGGGTAAAACTGAAGAATATAGAGCGAAAAAA
GCGTATGTGCAGGACAAGGGATACTTACGCCAAAAAAGACCATGTCCATTTTATTATAGG
ATACCCACTTGCACGGCGTCAAAGTACTCAATTGGCTGTGCTTCTTCAAAAAAACTAACA
TACACAAGAACCAAATTTAAATTCAACTTGGTTACCCAAAGAGAGAATTCATTATAGAAA
GATATAAAAATTTTGTAGAAAAAAAACAACAACGTTGGAA
Chr coordinates Chr VII from 532985-533821
w3c xhtml validator w3c css validator