Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS25A
Systematic Name YGR027C
Alias eS25, rp45, RPS31A, S25A, S25e, S31A, YS23
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps25Bp and has similarity to rat S25 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS25A YGR027C
AGTTCTCCTCAAGGATATAGGAATCCTCAAAATGGAATCTATATTTCTACATACTAATAT
TACGATTATTCCTCATTCCGTTTTATATGTTTCATTATCCTATTACATTATCAATCCTTG
CACTTCAGCTTCCTCTAACTTCGATGACAGCTTCTCATAACTTATGTCATCATCTTAACA
CCGTATATGATAATATATTGATAATATAACTATTAGTTGATAGACGATAGTGGATTTTTA
TTCCAACAACCTTGATATCTAAATATCCACAAGAATTAAACTAAAACAAGCCGATATATC
ACTCCAAATACTTTATTAAGGTGGTTGATTGAGCTAAATAGTTCTTGCCTCTTCAGTTCA
ATATAATGAATAGTACTTTGTACACTGAGTGGATTCTAGCCCGCTCAAAATAATATAAAG
CAAAATTCTATATTTTATATATGCATCCGTGCATTTGTGTAACCCATTCACCCATAAAGA
GGTTCATTTACCCTGTAACGCGCGAAGACAAAAAAACGAAGGACGCCTTCTACAGGAAGA
ATTGTGCGACAGAACAACTTCACGAAGTATCTCTTAAAGTTCACGAAGCATTTAATACTA
TTAAGATTGCTCAGTTGAATATTGAAATCGTATTCTTTGTTATCGAAAACCGTCAAGCCC
TGTTAGTTTTAGTGTATGTATCTATAAATTTGAAACCAATATTAGGCGGATAAGATGAAA
TAGTGACTGGCCAATCCAGGATTTAATATGTCATAAAAGCCTGTTCTACCTTAATGGGAT
GAATATCCATGTCTCTGTTATATGCTCCATAGCACAGATCTAGCTACCCATGGTACTTTG
AGAGAAGGAAACTACGTACTTAGTGGTGATTTACAGTTAAATTCAATCTACAATTCAAGT
CATTAGCAAATAGTCTTTATCCCAAATTCTACTAGAGTTCGGTTTTTTACTAACAAGTAT
GTTTTTACTTTTTACTTTATCATAGAACATTTAATAAATC
Chr coordinates Chr VII from 534458-534132
w3c xhtml validator w3c css validator