Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GSC2
Systematic Name YGR032W
Alias FKS2
Strain S288c
Description Catalytic subunit of 1,3-beta-glucan synthase, involved in formation of the inner layer of the spore wall; activity positively regulated by Rho1p and negatively by Smk1p; has similarity to an alternate catalytic subunit, Fks1p (Gsc1p)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GSC2 YGR032W
CTGCTCGTGAACGATGGACGCGGCCTGCGCTATTCATCAGGGCTACTCAATCGCATTATG
TGGTAGACGAGTATCTTCCGATCATCGGCGCGTTCTTTCCACGCTTTGAAACACGTGACA
TCGATGCGGGTCACTGGGTAAATGCGGAGAAGCCTGGGGAATGTGCCGAAAGCATCGTCG
ATTTTGTGGAGCGGCACGAGGATTAAAGGCAAGCGCCCCGGAGCAAGGTGCCAGTAGCAC
CAGTCGGTGGCTGTGCGCTTGCCGTAGCACATGACATACGGACTATTGTGTGAGTGGTGA
TGGGGTGTAGGCAGTGCCACACCAGTTTAAAGGCCTAGTAACGGCAAATCGCCAAAAGAG
ATGATGCTGATGCATACGATAAGATCGTCAGTTTCACGTTCGCGGTTCGAACATGGAATT
GTGGCTAAAGAAATTTGGGCGGTATGATGCAAATGAGGTGTACGTATGTATATATAGCAA
AGAGTAGAATAAAATGAGATAAAGCCTCGTTCGTTCTCTCCATTTCTTCCCTGTTTCTCC
TTTATTTTCTCTACTGCTTATTTCGAGTTCACCAGAGAACAAGAGAGCAGGAACGCAAAG
AGTGTGTGACACGAAATTCAAGATACAAAAATAAAAGCTTACGTTGTGTATTTCAACTGG
TGTGCTAAGAATAGAGTTTCATAAAGTACTGCATTTATTCATATATTATTTTTGTTATTT
GTATATATACTTCACACTTAGAGTTCTACTAAAAGTCTACCCAGCACGCATCCTTCGTTT
ATTTTTACATCTCTCTTTTGCTTTTCCTTTTTTTTTTTGGTGCTTGCTAGATACTACTGA
AGATCAAAGGTTACAAAGAACGCCGCATATATTTTCTGCAGGCATATTAAAGAAGTTACA
AAAGGATTAATCGAAGCGCTGTTTGGATACACTCCTGTAAAGAGAAGAAAAGGAAAAAAA
TAAAAAGTGGACAATAAATAATTATTAAACTGTCATAGTT
Chr coordinates Chr VII from 548264-553951
w3c xhtml validator w3c css validator