Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIM21
Systematic Name YGR033C
Alias FMP17
Strain S288c
Description Nonessential subunit of the Translocase of the Inner Mitochondrial membrane (TIM23 complex); interacts with the Translocase of the Outer Mitochondrial membrane (TOM complex) and with respiratory enzymes; may regulate TIM23 complex activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIM21 YGR033C
CCTCCTCATCATACACATTGTTTTACAATAATTTAACATTATTCGATTAATTGTTCTCTT
GCATTTTATGTTAACATTTTTTCGTGGACGGAAATTCACTCATGTTTTCTATCGTTATTC
GTATCCTCCAAACATACCTAGAGATTGCTTAGCCATATTTGATATATCTTTGGTCTTGCC
GTTGTTATTCCTTAAAAAAGAAGCACTGAGAACGGGCTAATACTTTAAAACAGTAGCCAG
ATAGCTATTGCTACTATTAATTTCCAAACACTATGTGTGTAAACGTATGAGATTTCCCAT
CCACGGCGGCCACCGTCTACTGACAACCCATCCTAAGCACTGACAATCTGAAAATTTCCA
GATCTCTGTGAGTCCCTCAAGCCGAGGACAGCAGAAAAAAAATCAAAGAGATATGATAAA
GCTCCTATTAAACCCAAACACCTTTAATGCACGGGTGTAAAAGGGATGTACTGGGCATCT
TTCGCTAAGTTACAAAATGGGCATTTCTTATTTTATTGTCTACAAGAATTTTTTTTATAA
AAATAACAACTAGGGAAACAAACAAGAAAAATTTATAATATTCATTGAATTTCTGTGACT
TTATTTTAATTTTTTTTTTTCCTATTGGTCAACAAGAAAAAAAACCGGATAATACCAGGT
CAGCTTCGAACCTGGACATGAAAAATGACGGAATACTGCTCTACCAACCACTGATCTAGA
TGAGTAGGTTAAATTTTTGGCCGCGAAAAAAAAAAGGTGTACATTATATGCGTCATGTCT
TTTGATTTTCCTGGTTTTTTCTTCACTTTTCTTGGGAAGTTTCGGAAGCTCCAATAAATA
AAGGATACAGAAAGCAGTGAAAAGATGTTCAGCTCTACTAGGTCAAACCTGAGGGCGTAT
TTTTCCGCCAGTGACAGCAGGTTATAGTTCTAAATTTAATTTTAGATATCAGGTTGGTAA
AATCATTCGTATATTATTTTCCTGACTCCAAGTTTAAACA
Chr coordinates Chr VII from 554967-554248
w3c xhtml validator w3c css validator