Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGR035C
Systematic Name YGR035C
Strain S288c
Description Putative protein of unknown function, potential Cdc28p substrate; transcription is activated by paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGR035C YGR035C
TTGCTTTTCCAGAGTTTACTTGCACTACCACAATTTAGATCAAGTAATCGTGGGATTCAG
CGTGGGGGCACTGACTGGATCACTTTATTTTTTTATAGTTGGCATCATAAGAGAGCTTGG
TTTAATCAATTGGTTTTTAAAACTACGTATTGTCAGATTATTTTACATGACAGATTCTTA
CAATCTGGCGCCTTTGACATTGAAAGAGAATTACGAGGCGTATTGGAAAAGAATAAATCA
GCGATCTTTCAATGATAAATCCAAAAGGGATTAGGTTGAACATTTCATTTTTCTTATTTT
TTCATCTATTTTAGCGAGGCGATCTTGAGCGTTTGTGTAACTGGATAAAACTTGGCAAGC
TGGAGTAGTCCTTATTTCTCATAAAGAAAGCCGAAAGCCTGCTCTCCTACAGTTATTAAT
TAAGAACGCTCGTTTTAAACAGTTACTGTGTAAAGCGACGGTAATCGAAAAAGTATGTGA
CATCGTGCAAAAGAAGATAATCAAAACCATGCAGAACGTAGAATAAATGTGAGTTCTATC
ACTTGCGGAGATAATACCCTCTGACGCCGCGGGGCCGATTGTTCCACGGAGGGAAAGAAT
CGGCCCTCGGGTTTTACGAGAGCGCCGCGGGTGAACTCACTTTTTTCTCGAGAAGAAGTT
TCCTACGGCAGAATAAGACCCTTTTCCACGGATAATCAGCGGAGCTTCTGGACATAATAG
ATGGTTTGTGAAAAAGCTTAAGGAAAGCCGCGGATTTAGCATGTCACCCACACTTAGATT
ACGAAAGCAAGGATTGCAGAAAAAAAGATGAGATACAGTTTTGAGGGCAATATATAAAAT
ATATAAATATAGCAACATTCCCTTCTCTCTGTTATGTCCACAATACTTCTAAAAGTTGTA
ACATATATCTATACATAAAAACTTGTAACAAACATATAATTAAAACAACTAGTGACAAGA
CGGAAGTTATAAGTTATCTTCTCTACAGAAACAATACGTA
Chr coordinates Chr VII from 557422-557072
w3c xhtml validator w3c css validator