Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name KSS1
Systematic Name YGR040W
Strain S288c
Description Mitogen-activated protein kinase (MAPK) involved in signal transduction pathways that control filamentous growth and pheromone response; the KSS1 gene is nonfunctional in S288C strains and functional in W303 strains
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KSS1 YGR040W
TTGGGATTCCATTTTTTATAAGGCGATAATATTAGGTATGTAGATATACTAGAAGTTCTC
CTCGAGGATTTAGGAATCCATAAAAGGGAATCTGCAATTCTACACAATTCTATAAATATT
ATTATCATCATTTTATATGTTAATATTCATTGATCCTATTACATTATCAATCCTTGCGTT
TCAGCTTCCACTAATTTAGATGACTATTTTTCATCATTTGCGTCATCTTCTAACACCGTA
TATGATAATATACTAGTAACGTAAATACTAGTTAGTAGATGATAGTTGATTTTTATTCCA
ACAGTATTTATGTTTTGTCATTCTTTTCTACATAATCTTGAAACTAGGTAGATCTACAAT
TGAAAAGTAAATACTAACATTATTTACTAAATTTAAGTTAGAAATCGGCACGAAAAAAAT
TTGACAGATTACGAGAGTCCAGCCAAAATATGAGTATATTACTATTTCCCCTTGGTGAAA
GAAATGAAAGATGTTATTTTTTACCGGCTTAGTAATACTGAGCTACTTACTTGGGGGAAA
GAAAGATTGGCTACTTATTATGTATGAAGCCTCAGATTACCTTGAATTCCTCAACCGTTT
GAGCAGTATGCTCTTCAAATTCGAACTTTTTGAACATCTTTCCTCCACATTCCTGATTTT
TTCACATTCAAAACGCGCTGTGAAGCTGTTAGAAATTTACAGATCGAGGCATATTTCTAT
ATATAATGTATTTTTATTAAGACACCCAAAGTACTTCCAATCTGTAGATATTGCACTTTA
TCTGACCAGAAGCCAGACTTGAACAGTTACATATTGTGCTTTGCAGTCGTTAAATTTCCC
GAACTGTTTTCGTATTTTTTTTTCTTTTCCTCTTTTCCACTGGATCAGATCAAAAGCCGA
CTAAAAATTTGGCAATTTAAAGAAAGCATCTTTTAAAGATAGAAAAGGTTATTTCAACAA
AAAAGTATCTTTTCTTCACTTTTCTTTCAACAATTCAAAG
Chr coordinates Chr VII from 575398-576504
w3c xhtml validator w3c css validator