Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RME1
Systematic Name YGR044C
Alias CSP1
Strain S288c
Description Zinc finger protein involved in control of meiosis; prevents meiosis by repressing IME1 expression and promotes mitosis by activating CLN2 expression; directly repressed by a1-alpha2 regulator; mediates cell type control of sporulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RME1 YGR044C
CTTCAGGATATATCAAAGTAAAAAGCAGCTCCTATTAATTCAAATTATTAGCTCAATCCT
ATAGCAACGTTTCTCAAGTTTAATTGTTTTGAAGGTTTTAGAACCTTTTTCACATTATTT
AGTCCGTCGAAACATCTACTCTTTACTATTTATGGCTAAACAGGCTGAAGGGTATGATTT
CTTTTCTTTTCTTTATTCATGTCGGGTAAGAGAAGGTCACTTGACCTATGATGTGGGGGC
AAATAATAACGTGGGAATAACAAGCGCGCTACTGGTAAGTGAAAAACTAAGATAACAGTT
GAATTTCGTGTTTAGATGCTATAGAGAGTCTGGTACAGCATTGGCGATTTAAGACTTCTC
TAGTCCACATTTCTTAAATTCAAAATCACAAGCGCCTGTTAACGATCATTTTATAATCTA
CGATGTGTAAATGCAAAAAGTGCTTTCCTCCCTCTTTAGTTTGGACAGGGATAGTGGGTA
AACGAGTAGCATTATGAGTGCATACATTGCCAGAAAGAAACCGCAAAGCGGCATATCTTT
TTTCTTCTTTCTGTTGTAAGGGATGCTTCGTCACGTAAAATGGCCGCCGGAGTGAGATGT
CACAGATTACATCAAAAGGTCGGCGTATACTGGATAAGAAAATCCGAACTTTTCCGGTGG
GCTTTACCAGCAGAAAAGTGGCCGGGCATGTATTAAATATATCACCGTATTTTCTGCTGG
CTTTTTCTTATGCAGAGAACAAAGGCCAGAGTGCCTTCGAGGAAATTAAAGGGAGCAATG
TGATAGATATGTCCTGTGTCATTTGCTTCAATTTTTCCTGCCATTTATTTGTAGTTATAT
TTATATCTAGATCAACCGAAACTATACCAACGACGAAGCTGCTTCTTAGTAAATATATTT
TCTACTGTGTCAACGCATTGGAACTGACATTGTTCTTATCCTATAAGTCATACAGTTGAA
TTTGTTAATTCTTTACTAGAAGTTGGGATTTTCAGCACTT
Chr coordinates Chr VII from 583892-582990
w3c xhtml validator w3c css validator