Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MUP1
Systematic Name YGR055W
Strain S288c
Description High affinity methionine permease, integral membrane protein with 13 putative membrane-spanning regions; also involved in cysteine uptake
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MUP1 YGR055W
CTCCACAAATGCCCCCACAAACAATAAAGAAACTTCTCCAGAGGAGAAGAAAATAAGATC
TTTACTAAAGAAATTAAGGGCTATTGAAACCTTGAAGGAAAGACAGGCCGTCGGTGACAA
ACTAGAAGATACGCAAGTTCTAAAAATTCAAACTGAAGAAAAAGTGTTGAAAGATTTGGA
AAAGTTGGGTTGGAAGGATGAATAAACTAGAAGAAACTGATGTATCCATACAACTGTGTA
AATATTAACAACGTCAAATAATACTACTTTGAATTGTTTTTTACTGTTTCCCAGGAGAAT
TACGCCAACCTCCCCCCTTTCTTTTTTTCCCTTGTTTTATTGTACTTTTCCACATATTTT
TTTAACATCAAATAGTAATTGATACATACATAATTAGTGAGCATTTTCCTTATTTTTACG
TCTCTTCTTGGCGGATTGCCACCAGCCGCATCTTACAATGTATGCCACGATACCGCCAGG
CAATAAATGAATATGGAGTGTCACTTCGGCTCCGTAAGCCGGCGCTGCATCCGCCACCAC
AGTTTTTTTTAGCGTCGCTGTCGCCGCTTTGCCACAGAAAAAGAAAAAAAAAAAAGAAAC
GGCGCCGTGTAGGGTTTTGTATAACAGATCGGCCTAGCAGCCAGGAGATGGCACGGCGCC
AACTGAAAAGTTAGACTGTGGAATTGCCGTTCACCACACTCGAGTGGCATCTAATAAACT
GCCACAGTTGACTCAAGCGGTGCTACCTTCGCAGTTATTGCACACCATGGTAACACATAA
CACAGTCTTGCATTACAAATGTGGTTCCTCCTACTTGGCGGTGAATTTCTTGAGTCAGCC
CGTTATTTTCATATGGTGATGTAAGATTACATACAGTATATATATATAAGGATGATTCTC
ACACAAACTTTTCCGCTGTTCATCATATTTTGTTTTTGGATTAGTTTCACATTCTGTAGA
AATCTTTAAAGACAAGAGAAGAGAAAACAAAGGCGGAGCA
Chr coordinates Chr VII from 599417-601141
w3c xhtml validator w3c css validator