Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRP38
Systematic Name YGR075C
Strain S288c
Description Unique component of the U4/U6.U5 tri-snRNP particle, required for conformational changes which result in the catalytic activation of the spliceosome; dispensible for spliceosome assembly
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRP38 YGR075C
CTCCAGCTAATCAATACACATAACAAAAAGCTACTTCAACAATTGTGGGAAATGGTTTCG
AGTCTAGAATCCTCCCTAGCCATCGACTGGTGGTACACAACGGTCTTATCAAGTCAATCT
TCTAAATTATAGTATCATTAAGTACTTTATAGTAGCGCCTTTTTATATTCCTTTTTTCTC
AAACAAAAAAAAAAAATGACTGGGATACAAGTGAAAGTGGAAGAGCAAGTGAAATACGAA
ATAAAGTGAACCATTTATACAGAATAGGAAAACCAACTAGTGCATTAAACTAAACTCCAT
GTCATACAAACAGTATTTTGATAGTTTGCCTTTGAAATTGAAGTCCTTTTTCCAAAGATA
CCCCCCTTCAATCAAGTATTCTCCAGTGTCTACATCTACTAAAGCCATTAATGCCAATCC
TTTCCTGCCAAATAAACATCCGGTCACACAACGATTTCATGATCCGAAATATTCACTTAG
AAGAATGAGTGACGTATATAAGTTGGCACTGCGTTATGGAGTAGAAGAGTTTTTACCACC
GATCGAAAACACTAAGAAACTTTTCTTCGAGGAGAAATACAATAAAAAGACCCTCATGAA
AGGTGTTCTCTTGCCCAAGGGTCATAAGCATGAATTGAAATTAAACGAAAAGCTAAAAAA
ACGTGAAGAAGCTTTAAAGAAGGTAGATGAGTTGATTGCTTCCAAGAAGGGTTCGAAGTA
TGCCAAGAGAGTAGAAAAAATGAAAAAAAACCAAAGTATAGGCTGGTTCTGAAGAATAAG
AGAGAAGATAACTATAGTTTAGAATAGTAAACCCTATGTGTACTGTTTTATGTTTTTAAT
GTCTAATCATGTAAATAATTTTGTGATATCAATAACGAACGTTCTGAACAAGAATTATGA
TAAAAAAAAGTAAAATCTAAAGCCATTACAACGCTATATTTTCAGTGGCAGTAAAAACGC
AAGAACAAAAACAAAACGTGGGTAAAGAACAAGGACTACA
Chr coordinates Chr VII from 636875-636147
w3c xhtml validator w3c css validator