Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SLX9
Systematic Name YGR081C
Strain S288c
Description Protein required for pre-rRNA processing; associated with the 90S pre-ribosome and 43S small ribosomal subunit precursor; interacts with U3 snoRNA; deletion mutant has synthetic fitness defect with an sgs1 deletion mutant
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SLX9 YGR081C
ATATATATTACACCTAATACGATGAAAAAATACATCTAATGAAAAGAATTGTTTTTATCC
TTAGCTTTCCAAAAAGCTTGGTATATATAACAAGATTTAGGCTAGAGAAATGATGTAATT
ATATAGGGCTATATACAGAGTAAAAGAAACAAAAACGGAGAAAAAAAGCAAGCAAAATGT
TACTCTCAGTCATCGATATCGTTAGCTTCAGCAACCGCATCAGATTCGGCCTTGCTTCCA
ACAACTCCTTTAACGAAAGAAGCCACATTAGCAGGAGGCAAGATGGCAATCATTAATATA
ATATATTCGTAAATGGCTTCAGGAATGGATCTTTGGTAAATTCCCAATAAATCGGCTGGC
TGAGGGTATACAGTCAATGCTTTATAAAACTTAGAGGCTGCTTCCAGTTCCTTACCTTGT
TGCATGGATAATCTTTCACCATTTTCTACGTTGGTGGTAAATGTAGCTTCTCTTTCGGAG
GGATCACTAGGGATGGGGTCCTTGGCTAATTCCATGGATAAGAATTCGGTAACCTTTTGC
AGCTTCACTTCCTTAGCATGAGTTTTAGCTTGTTCTTCCATCTTGGCCTGCTCTTTGGCC
CTTTGTCTCAACACTTTCCTGAATTGCGGGCTATTTCTTCTTTGATAGTCAAAGTAGATA
GCATAACCGGTGGCTGATAGAGCTGCTATGGCTGTTGTAATAGCGAGGCCACGTAAGATA
GGGTTCGACTGGGACATAATAGAAAATAAACTTTATGAAGGTGGCACTTGAGGCAATGTT
TCTTGTAGGTCTAGGCGAAGGGACAATAGGTAAATAACGTAAATGTCGGCCATTATCAAG
GTGAAATATTCCTGTATAAAAAATGTTATTCGGCGCGAGAAACTGAACGGGGTGACGCAC
TGCAAATTTTTCATGTTTTACATACTCAAGCATTACAGACTCGATGAGCAGAGATAAGAG
ACAGGAAATCCATTGAATATAGAAGCATAGATAAGCGATA
Chr coordinates Chr VII from 643780-643148
w3c xhtml validator w3c css validator