Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRP13
Systematic Name YGR084C
Alias mS44
Strain S288c
Description Mitochondrial ribosomal protein of the small subunit
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRP13 YGR084C
CCATACATTACTTTTTTTAATATTCTTTTTGTTTTCACCGCCTTCTTTTTATTTTTATCC
GAAGATCTTTTGGAACCCGCTCTGCGAATAGCGAAGCTAGGATACCAAATTGAAACTTGG
ACATAACTCATCATTAAAGAAGTATACTGTTAAGAGAGGCATTCATTTCGTGTATTATAA
CGTTTAGCATCAGTTACCCTTGAAAGCCCAACATATACAAAAATACGCGTCCAAGATGTC
TACTAAAGCCCAAAACCCTATGCGTGATTTGAAGATCGAGAAATTGGTCTTGAACATCTC
CGTTGGTGAATCTGGTGACAGATTAACCAGAGCCTCCAAGGTTTTAGAACAATTATCTGG
TCAAACTCCAGTTCAATCCAAGGCCAGATACACTGTCAGAACTTTCGGTATCAGAAGAAA
CGAAAAAATTGCTGTTCACGTTACCGTCAGAGGTCCAAAGGCTGAAGAAATTTTGGAAAG
AGGTTTGAAGGTCAAGGAATACCAATTGAGAGACAGAAACTTCTCTGCTACCGGTAACTT
CGGTTTCGGTATTGACGAACACATTGACTTGGGTATCAAGTATGACCCATCCATCGGTAT
TTTCGGTATGGATTTCTATGTCGTCATGAACAGACCAGGTGCTAGAGTCACTAGAAGAAA
GAGATGTAAGGGTACTGTTGGTAACTCCCACAAGACAACTAAGGAAGACACCGTCTCTTG
GTTCAAGCAAAAGTACGACGCTGATGTGCTCGATAAATAATTTGGTCTCGGTATAGTCAG
TGACAACATCAACTACTTAATATATAAGAACAAATAAAATATCCCAAAAATATCATATAT
CCTCATCACATTTGCAAGTCTAGCGCTTCGATGCGTTGTGAACACTTTGTCAATGTATTT
AGTTGTATTCATACCCAATTTATTGGCACTTATTTGATACTCACCATGCAGGGTAATAGA
AAATGTGCTGAAAAAAAGCTAAACCTTTCTTATTAAGAAA
Chr coordinates Chr VII from 648142-647123
w3c xhtml validator w3c css validator