Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NNF2
Systematic Name YGR089W
Strain S288c
Description Protein that exhibits physical and genetic interactions with Rpb8p, which is a subunit of RNA polymerases I, II, and III; computational analysis of large-scale protein-protein interaction data suggests a role in chromosome segregation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NNF2 YGR089W
GACGAAGTAACAGAAGTTTCTGTGAGAAAACAGGAACAAGACCAAATCAGAAACGAGCAT
ATTGTTGATGCCAAAATTAATCAATATTACTACGTTTATGGTATTAGTCCACTAGACTTC
GAACAGCCAAGAGCTCTATATGAAAAGGTATACAACGATGAACAGAAGAAATTATTCGTT
CATAACGTTGTTTGCCACGCTTGTAAGATCAAAGATCCTAAAGTCAAAAAGAGAGTTACG
CAATACTTTGGTTTGCTAAACGAAGATTTGGGTAAAGTCATTGCAGAATGCTTGGGAGTT
CCTTGGGAACCTGTTGACCTTGAAGGTTATGCCAAGACTTGGTCCATTGCAAGTGCCAAT
TAAGGCAGCACTATTTATTCATAATTATTCGTAATTATATCTCCATAATTATTTATTCAT
AAGTTTTCTTTAAGTTTATTCTCTACATCACTAGTTATTACAAATTGGTCGTATGTACAA
GCACTAATATTTCATACTTATCGTACTTCATACATAGCAAATCCTGTTAGGAAAAATATG
GCAGCAAAACAGATTGGCTGCCTACTTTTGACACATTTTTTTCTAATTCGGTACTTAGAT
CGGCATGAACTCAACGATTATCGCATTATACGGACAATCTGAAAAAAAAAAGTAGCCTAA
CTTATGCAGTTGTGTGTTTATAACGTTGAATTCCTAAACCTCTTGAAGGTGTAATATAAC
AAGTAACATAACTAGGTTTTCACAACTCGTTAGTTTCTATTAAAAGAGGAATAAACAAAT
TTTATTAGGACTAAGAGGATTATACAGAGTACCAGCAGAGAAAACTTTAAATTCTTTCTG
TTATAATAATATCTTACCAAAGTTTTTTGTTTTCTATCTCCACATTTTTCGTACCATCTC
TTTAGGTAATCACTCTGAATAACTTTTATTCATATACACCCCAATATTTTTTAAGATTCC
ACCTATCTCCGTTACATAAAAGGATCCATGCACAATTTTC
Chr coordinates Chr VII from 656960-659770
w3c xhtml validator w3c css validator