Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPT6
Systematic Name YGR116W
Alias CRE2, SSN20
Strain S288c
Description Transcription elongation factor required for the maintenance of chromatin structure during transcription in order to inhibit transcription from promoters within the coding region
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPT6 YGR116W
TTTAACCAGCCGCTATTTCCCTCCTCACAAGTAAGAAAATACAGGTCATATGACAACAGA
GACAAGAGGAAGCCCTCCAAGATAGGCAACAACTTACAAGTAGAGAATGAGGAGGACTAT
GAAGACGATACTAGTAGTGAAGCTTCTTTTGTTCTAAATCCAACAAATATCGGTATGTCC
AAATCATCTCAAGGTCACGTGACTAAAACCACGCGTTTGAATAATAATACCAACAGTAAA
CTGAGAAGAAAGTCCATCTTACATACAATCAGAAATAGCATTGCTTCCGGCGCTGATTTA
CCCATCGAAAACGACAATGTTGTTAATTTGGGAGATCTGCATCCAAATAATCGAATATCA
CTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAATG
TTCTCAGGACGTGCTGAAAGGAAACCCACAGAAAGCAGACATTCTGTTGCAAAGAAAACT
GAAAAAAAAATAAATACAAGGCCCCCCTTCAGATGACTACGCCCAACCCAACCAAAGAAT
TATCCTCCTCACAAAATATATCGCTAGCATGCGTGAGTTATGGATAAGAAGAATATTTGA
TGAGCTGACTGATTCTTTATAGCAATAGGGAGGAAGGCAGTACACATATCAGCAGTGCAT
GGGCACAACCCGCATTACAACGAAACATGATATATCTATATAAAAGAAGATACGGACAGG
CGGTCGAGGCTATTACTGTGCCACTATGCGAGTCATGAATGATTTTTAAATTAGTTAGTA
CCCCTTTATATAACGTCTTCAATAAAAGTGCGGGAAAATTCGGGTAATATTTTCTATAAC
TGTCATTTTTTTTTCGTTATGTATGGCAAACCAAATTGACAAGAAACTGGACAACGGTTA
AAGCAAAAGGAGGAAGAAAGATATTGATTTGTGCTTTGAAGAATAACCCAAGCGAACAGG
TCATTAATTGCCTAGAATCTTTACATAGAATTTGCCTTTT
Chr coordinates Chr VII from 720409-724764
w3c xhtml validator w3c css validator