Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGR117C
Systematic Name YGR117C
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGR117C YGR117C
GCTTGGATTCGATACCCAATTTTTCCAAGACGATACCCTTGGCATGAGAAGAACCACCGA
ATGGAGAAGACTTGAAGGCAGTACCCAACAATCTCTTCTTGTAGTTGTTTTCGGCCCAAC
GGCTATAATAATAAAAAAAAACTGTTAGTAAAAAAATGATTCCGTTGTAAAAAACGGCCT
CCTGTGACTTTCTGAGTTATTTTGGGAAGAAAAGGTTTATTTTCCACACTATAGATTGGG
AAGAATGGCCGAAGCTGACCGTTCACTATTCATTACTTTTTATCACTGTGACGTGTCATT
TTAAGCCTCTCCAAACTGATTTGCGCCAGGATATGTTACTGATAAATTTATCACTCCAGA
GCTCACAACATTTCCTTCACCTAAAACGATATCACAATAGGGGGTTGATAGTTTTTTTTA
ATTTTGAAATAGTCAACATACTTGTTTCTTCTGTGGACACGTAGCTTTCTAGCAGAGTTC
AAACCTCTTGGCTTACCTTTACCCATCTTTGTTTATTTCCTGTTGTCTTAGGTTTTTGTA
AAATTTGACATTATCTAATATGTCAATTCATAGGCAGTATCTAATTTAACGTACTGTAAC
CGTTAGTCGAAACATTGTGATATTACGGCAGTGTACTCTCGGCGTAGAGAACTCAAACCT
CCGCTACTGCTTTCCGTCAGCAATCGGCAGAGATGAAGGGGCCTTTCTCGGGAGGAGCTC
CGCTGGGTGTCTCCCATGAACCAGCCACAAGAGCAGACCTTCTGAAAGGGTATTCCGCCG
AAACGTCATTTCTTCCTTCCAGAGCCCGCGTGCTGATGCAGAGTGGTCTTTCAAAATGAA
GTTTACTTTTTATATTTAAAAATAGGGTATGGGTGTATATAGGGTATGGGTGTACAGTTA
ATTTCAGAAGGAAAGAAAATGTATAAGAATGGCAAAAAAAAAAAGGACATGATTTCAAAC
AGGTAAGTGACAGTGAGAAGAAAAGTCTAGTGCGACCGAC
Chr coordinates Chr VII from 726479-725049
w3c xhtml validator w3c css validator