Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MEP1
Systematic Name YGR121C
Alias AMT1
Strain S288c
Description Ammonium permease; belongs to a ubiquitous family of cytoplasmic membrane proteins that transport only ammonium (NH4+); expression is under the nitrogen catabolite repression regulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MEP1 YGR121C
TTTGTTAGAGCTACTTTTCACTTTAAAGTTCAACCTTTGAATAACCAGTTCTCGATTATA
CGTTTTTTCTTACAGCCGGTTTACGTCAGCGCAGGAAAATTGAAAACTATACTATTCAAT
ACATAGAACGTAACACAATGGCGTCCCCTCAAAAGTGTACACTTCTTCAAGATGTTACTG
CGGCTACATGCAACACCCCTAGAGCTATTTGTAAGGGAAGACAAGATCTCAAGTGTTACC
ACAGCCCGTAATTGAGTTCGGCACTATTCGAGCGCACAAAAAATCCCGTACTGTTTTTTT
TCAGATAAGAAAGACTGAGCCTATATAAACACTACCTGAACCATTTTTAAGATAAAAGTT
ATATACGATAGAGTTATCCCCTCTTAATAATTGATCAAGAACCTCTGAAGCACAAAAGGG
AGCATAAGAGCACTTAGGGACAAACGTATTTCTTTCCCCCACTCCCCTTTTTCCCTTTGC
GATGCACATCCATAACTTGTACTTGTGTCTTGACATTCTTCAAAATCAACATGGCGATGC
TCTTCTACGGTTGTCCTTTGCCACGAACTTTGTTTTGCGCCTCCCCTCCCTTTGTCAGGC
TGAGTGCAAAAGAAAAGGCCCTGGTTGCTTATCTCTGCGGACACGCGCCCCTCTTATTGG
ATGAGACATCTCAGAGATTGCGATAACGATAAGATTCACAATTGCTACAGACACCCTTGT
GTGACATCTTATGGCTATGTAAGCACAGAAGAGAAGAAGAAAGAAATGACAAAGTATTGA
TGGAAGATGTTTTTCCTGAAAAAAAAAAAAAAAAAAAATCGGAAAAGTGGTGTAGGCTTC
TATAGCACCTTCTGCTTACCAGTCGATAATGCAGTTCCAGAATAAGATACTTAAAAGGTA
GTTTATTTATATAGGCGCTCTTGTAACTTGTTTAGGCTTATGATCAGAGAATTATTTTAG
TAAACATAACTGCAGTACGGATTCTTATACTGTAGAAACT
Chr coordinates Chr VII from 732927-731449
w3c xhtml validator w3c css validator