Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PEX4
Systematic Name YGR133W
Alias PAS2, UBC10
Strain S288c
Description Peroxisomal ubiquitin conjugating enzyme required for peroxisomal matrix protein import and peroxisome biogenesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX4 YGR133W
TCAACTGCTTTCGTGAATTCGGGACCAAACGTCATATGAGTGATAGAGACATCTTCCAAC
TTAATACCGAATTCGTTGGCCCTCGTAGAAAGCTCTTTTCTGATTTTTTGAGAAATAATT
TCTCTCTGAGTAATTAACTCAGCAGCATCAAATTGAGCTACTATAGACTTTAAAACCTCA
TTGCCGATAGATGGTAACACTCTTTCGTCGTAATCGAGACCCAAATTTTGGTATATTGCG
GGTAGCTGTAAGACCTCTGGTCTATGTAAGACTCTCAAGGTCAATGACACCATTTGCAAA
TCCTTCGTACCAGTATTGGTAGCAATGCTCTTTGGTTTCGTCCTCACATCGTATATGATC
GCCTTCTGTAGCCAAGGCACCAAGAAATGAGTGCCTTCACCCACAACCTGTTGCTTTACA
CCATTGATTCTGTCGAAAATAACACCACGAGAACCACCCTTCACATCATACATGGAGTAC
TGAATCCCGCTAGCAATTATACCAATGGGCAACGCCACCTTGGTGATGACATCGATAAGT
TTGGCAGAATTAGACATTCTTTTCTAAAGTAAATTATTGATTTTGAATGTAAGTTTCGTA
CCGTTGATGGTTGGTTTACCGATTTATTTTTTTTCCTCTTCTTTCTGCTTAATATTATAT
ACCTCAACCGTTGCATCCATGAGATCGTCAAACTCCCTTTCCCTGAAATTTATTGATGCG
ATACATTCGCGTTACCCGTATCATCATGAAGACGAGTTTATTCTCATCAGTGTTGATCTC
TCATACTTGAATAACTCATTTGCAATGGTCTAAGACTCCAACTATGTAGTCATAGTCATT
CACTGAAGTTTCTCTTTTCGAAATCCTGAACGGAAGCGGAATATATGTGGTATATATCGC
ATATTACTGCTTCACAGCATGCAGCGCAGACTGGCCGGGTTATGCTGCCACTTACTGGAG
ACAACATAAAATATACATAATCATCGCCTTTATACATAAT
Chr coordinates Chr VII from 756896-757447
w3c xhtml validator w3c css validator