Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TPO2
Systematic Name YGR138C
Strain S288c
Description Polyamine transporter of the major facilitator superfamily; member of the 12-spanner drug:H(+) antiporter DHA1 family; specific for spermine; localizes to the plasma membrane; transcription of TPO2 is regulated by Haa1p; TPO2 has a paralog, TPO3, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TPO2 YGR138C
CCTATGCAAAAACCCTTCCCCTGATCTATTTGCCATTTAGCCGCCCAAAGTACCGCAGAA
GCTGTTACAAACACATCACGGGCCACCGGAAAAAGTATTTTTTTGCTGCTTACCTGAATA
TATTTGCGCTTAAAAAAATTTTCCGGCGCTTCCGAGTGAAATATACTGCTTAACTGTGTC
CGGAGAAACCTCGTGCGGAAAACAGCGCAAACCGCAAAAACCCCGCAATGGGCGCGCTTA
CTCAAATTCCCTCGGGTGGTCTCACGGGCTGGCCGCAGCGCAGTCGCCTGCCGCACTAAA
CCTTAAAAATGCGAGAGCGCATGCACGGCGGACGTCGTGGAAGCCTGACGCGTGCGCCCT
TCTCCTCCCGAGGGACATAATGTCTTGGTGCCTTACTAGAACCGATTTCTCGAGATGATT
CCATAGCCGTTAAATTCATCTCAAAAGAATAGAGAACACAGCAGCGCAGAACGAAAACAA
ACTGTCGCGTCGCATTTTACTGAACGAGTCATTCGCATATTCTGCTTAGGTGTCTGAGTC
TTTTAAACGCATTCTAGGTTTTTCGAAAAAGCCACCGAAGAACACTGCCATCCGCATGCA
CTGTAATGCCACTGTTTATTTTTTTTTCTTGCTATATATATACATTGCGCATACACCCTT
TTGAGGTTTCGTACTAGGATTTTTTTGTATTTGTTTATGTTCTTTTTTCCTGAAGACATC
AAGAAGAAATAAGAAAACAAATATATCATTTTATTGTTTGTGTTTATAGAGAACAATATA
CAACTTCCTTCTCCTACTATATCAAGTTTAATATTTAATTTTTTTTTTTTTTCGGTTTGA
ATTTTAATTTTAACTTTAATTTCAAAAAGTAATTGATACATTCTTTTATCAAAGCCCTGC
TATTATTCTTTATTTCTACACCCTAATATTTTTTGTCCATTGATATTTTTCCTTTAATTC
CATCTAATAACTAATCACAAAAATAATACACAAAACAAAT
Chr coordinates Chr VII from 765606-763762
w3c xhtml validator w3c css validator