Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TPO2
Systematic Name YGR138C
Strain S288c
Description Polyamine transport protein specific for spermine; localizes to the plasma membrane; transcription of TPO2 is regulated by Haa1p; member of the major facilitator superfamily
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TPO2 YGR138C
CCTATGCAAAAACCCTTCCCCTGATCTATTTGCCATTTAGCCGCCCAAAGTACCGCAGAA
GCTGTTACAAACACATCACGGGCCACCGGAAAAAGTATTTTTTTGCTGCTTACCTGAATA
TATTTGCGCTTAAAAAAATTTTCCGGCGCTTCCGAGTGAAATATACTGCTTAACTGTGTC
CGGAGAAACCTCGTGCGGAAAACAGCGCAAACCGCAAAAACCCCGCAATGGGCGCGCTTA
CTCAAATTCCCTCGGGTGGTCTCACGGGCTGGCCGCAGCGCAGTCGCCTGCCGCACTAAA
CCTTAAAAATGCGAGAGCGCATGCACGGCGGACGTCGTGGAAGCCTGACGCGTGCGCCCT
TCTCCTCCCGAGGGACATAATGTCTTGGTGCCTTACTAGAACCGATTTCTCGAGATGATT
CCATAGCCGTTAAATTCATCTCAAAAGAATAGAGAACACAGCAGCGCAGAACGAAAACAA
ACTGTCGCGTCGCATTTTACTGAACGAGTCATTCGCATATTCTGCTTAGGTGTCTGAGTC
TTTTAAACGCATTCTAGGTTTTTCGAAAAAGCCACCGAAGAACACTGCCATCCGCATGCA
CTGTAATGCCACTGTTTATTTTTTTTTCTTGCTATATATATACATTGCGCATACACCCTT
TTGAGGTTTCGTACTAGGATTTTTTTGTATTTGTTTATGTTCTTTTTTCCTGAAGACATC
AAGAAGAAATAAGAAAACAAATATATCATTTTATTGTTTGTGTTTATAGAGAACAATATA
CAACTTCCTTCTCCTACTATATCAAGTTTAATATTTAATTTTTTTTTTTTTTCGGTTTGA
ATTTTAATTTTAACTTTAATTTCAAAAAGTAATTGATACATTCTTTTATCAAAGCCCTGC
TATTATTCTTTATTTCTACACCCTAATATTTTTTGTCCATTGATATTTTTCCTTTAATTC
CATCTAATAACTAATCACAAAAATAATACACAAAACAAAT
Chr coordinates Chr VII from 765606-763762
w3c xhtml validator w3c css validator