Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BTN2
Systematic Name YGR142W
Strain S288c
Description v-SNARE binding protein that facilitates specific protein retrieval from a late endosome to the Golgi; modulates arginine uptake, possible role in mediating pH homeostasis between the vacuole and plasma membrane H(+)-ATPase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BTN2 YGR142W
GTCGGTCAACATGCGCACGATGTTCCGTTTTTCTTTATGCCATTGAGTGACTTTACTGAT
AGAGGGCCATTATGGGATCCTTCTTTAAACTATTATGCCTATACAGTGACTGTGGGGGAA
AAAATGACACCATGCGGCGCTGAAGAAACTAAAATGGGACTAGAATGGCTATCGTTCAAA
GGCGCTTGGGGCGATAAACAATTAAGACCTAGGGATCCCAGACAAAAATGGTGCCCATTT
CAATGGAAATATATTGACGGACCAAAAGGTCCACTATTCAAAAATATGGAAAGGGTTTCT
TTATGCCAAAGATTTAAATGGTGGAATTTTTGGAAGGGCTGCCCGGCAAGAAGATATATA
AAAAGAGGGGAAGGTTTGGATGCAGAAAAGAATGATCTTGTGGGTGACAATTGTGGTATC
TTGCTGTACAACATAAGGCCAAAGTGGCTGCGTAGCATACTCCGTTTTTTGACGTGGAGG
GGAAGCGTATGTTTCATTATGGACTACTTTACAGGGTAATGAATATTTGGGCGTTTTTCG
CTATTTTAGCATGCTGTAGTGTATGTACTGTGCATCGTCATGTAGCACTATTTCAGCCGT
ATTTTTCTTTTTTTCTTTCGCACCGTCTGTGGTTGTAAAGTTACTGACACTTTTTTTTCT
AGAAAGTTCCGGAAAATTGCGACACTCGGTGGAGCTCGAGAGTTGTATCCAGTTTTCTTG
TTCGGCGATATTCCGAACCAGGTCGGGTTGGGCTAACAGCCGCCCAGGATGGAAGAATTA
AGAATTTCATAGAAGCCTTCAGTTCTTGGCGAAGTAAAGTGGCAAAACAAATGGAAGATC
TATTGCATTACATATATAAAAGCATTAGAACAATCTTTTCTCATTGACAGGTATTCTCAT
TGCTCTATATATATTTTCTTCTTCTTGAAAGAAATATCAGTATTACAATCATAACAACAA
CCAAAAGAAAATAACTAATAGACCCCATTACAATATAGAA
Chr coordinates Chr VII from 772454-773686
w3c xhtml validator w3c css validator