Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ENP2
Systematic Name YGR145W
Strain S288c
Description Essential nucleolar protein, required for biogenesis of the small ribosomal subunit; contains WD repeats, interacts with Mpp10p and Bfr2p, and has homology to Spb1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ENP2 YGR145W
TTTGTTCTTACAAGAGTTGGAAATCCCTTACGAAGACGAAGGTGACTATGTTGTCGTTAA
GCATGCCGCTTTGTTCATCTCTACTGTCCTTTCAAAGGTCTTGCAATTACCAAATGTTAA
ACTGTTCAATGCTACCTGTGTTGAAGATTTGGTTACCAGACCACCTACCGAAAAGGGCGA
AGTCACCGTTGCTGGTGTTGTCACCAACTGGACGTTAGTTACCCAAGCTCACGGTACTCA
ATGTTGCATGGACCCTAACGTAATTGAATTGGCAGGTTACAAAAATGACGGAACTCGTGA
CTTGAGTCAAAAGCATGGTGTCATTTTATCCACTACCGGTCATGATGGTCCATTTGGTGC
TTTCTGCGCCAAGAGAATCGTCGACATTGATCAAAACCAAAAATTGGGCGGTATGAAGGG
TCTGGACATGAACCATGCCGAACACGATGTCGTTATTCACTCTGGTGCATACGCCGGTGT
TGACAACATGTACTTTGCTGGTATGGAAGTTGCTGAACTGGATGGATTAAACCGTATGGG
TCCAACTTTTGGAGCTATGGCTTTGAGTGGTGTTCATGCTGCTGAGCAAATTTTGAAACA
CTTTGCTGCTTAGGCTTTTAATGAGGTATGCTTTTAAAGATTTATATATTTTTTATACAC
GCTATATACACAATTTTCGCTGATGATTTTGTTTTATTATTGATTTTTAAATTAACCGTA
GAAAATACTAAGTGGAAAGATCCGATAGTGATGAGATAAGACTTTTAGTTATCTCTGTAA
TGGTGAGTTTTCGCACATCTTGCAATATTAAAAATATAAATCAATTCTTCAAATGTCACT
TCATGGTCGGGTAACCAAATATGATCTTAAAAAAAATTAAGAAAAAAAAAAATTGAAAAT
TTTGAGCTAAGCTCATCTCATCTCATCGGCTGTAATCAGTAACACATCATTTATTACATC
AGTTACAGGTATCAACATATATCTTCAAAAAGGGGACATT
Chr coordinates Chr VII from 781767-783890
w3c xhtml validator w3c css validator