Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ECL1
Systematic Name YGR146C
Strain S288c
Description Protein of unknown function, affects chronological lifespan; induced by iron homeostasis transcription factor Aft2p; multicopy suppressor of temperature sensitive hsf1 mutant; induced by treatment with 8-methoxypsoralen and UVA irradiation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ECL1 YGR146C
ATCCTGCTAGCTGTACCCCGGCCGAGCCACCCAATGAGCACTGAGGAGGGACCTCCACGT
GCCAAACGACACTCAAACGGCAACAACAGATCGTATTGTGCCGCCTGAAGTCGCATTAAT
TCTCAACGGGAAGCTCATCCCTCAACGAAAATCCTAGTGCGCCTTTCACATATGTTCCAG
AAGATTCGCTTAGTCGGCCAGCTAAAGCGGTTCAGCTTTTGAGCTAAAAATACTTGGAAA
AAATCTGGCCGTGACCATAGGTTACCGCGGAATAGAGGAGAAGTTTTCATCTCTTTTTTT
CTTAATGTAGGGCACACGACTCGGGTGTATTTGCTACCGTGTTTATTACCGTCATTCATC
GCCCCATCTCATCGCTTTTGCGCACCGGGTTCAGATCATTCAATTTTCTTACTTTTTTAT
TATGGGGTTCCTCCCTGAGTGTAATTTAACGTGTGCTTTCTTATTGCATTCGTTTACATT
CCCTATTGCTCATTGCCCTTCTTTCAGTTGGGCATCTTTTTTTTTCACAATTAGGCCGCC
CTTTTTTCCCAAATTGGCACTTGTTTGTACGATCTTTAGCTAGAACTTGGAGACCTGAAA
CGTGGTGATTCTTATATTTAAAGGAATACCGATCTTTTCCGTTTCAACACCCCAATTGTG
AGAATTTTATTTCTTGCATTTCGGAAAATTTAGATACATTCACATCCATACTTGGACACA
TATATATATACAATATAATCATTGACACAGGCCATCGCCATTGAGTAAACTGTCTTTGAA
CTGTCTAAAGAACTTAGAACTATAGTGTTGTCCCAAGAAGTTAAAAATTGAACACTTGTG
AGAATTATAAAACAGAGTAAGCAAAGAAAGAATAGAGAAACAATACTCCGCTACCGATTC
TCCTTTTTTTCCTTATAAAAAAAGCTCGAGAATAATTACTTTATTCTTATCCCTCCACTC
CTTTCAGGTATTCTTTACCGATTTGCATATCAATCATATA
Chr coordinates Chr VII from 784858-784223
w3c xhtml validator w3c css validator