Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPC1
Systematic Name YGR149W
Strain S288c
Description Glycerophosphocholine acyltransferase (GPCAT); involved in in phosphatidylcholine (PC) synthesis; uses acyl-CoA to acylate glycero-3-phosphocholine to yield lyso-PC; also catalyzes acylation of glycerophosphoethanolamine with acyl-CoA; predicted to be an integral membrane protein
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPC1 YGR149W
TTCAACGTTGATTAATATAACGCCTTTATCGTGGGCCTCTTATTAACCTCAGCATTGTTC
AAATGGTCGCTTCTTTCTCAATTCCTACACTGCGAAGCTCCTCGTTGTCCTCAATATTCT
CTCATTTCCTAATGGGCACGCGACATACGTTTCAATTCAAATTGTTGCTCGCCTCTTTTG
TTGACCACCCAAAAATTTAAACGCCTATAATTTAGTTAATCAATATAGGTTACCTGTAAA
TATTGGTAATATCAACTCCCACTACTACTGTTTCTGGCTAGATGTCAACTGCGCAAGAGC
AATCAGGCCAAACGGGAACTCCCGTCAACCCATGGCTGGAGTTCCCTCAACGGGAACCTC
TACATTCTCCTACAGAGGCGCAGGCTCACGGTAAGGAACCCCCGGTAGTGTTGCGCGCTC
AACGACGCGAAAGCCTTAATTGCCGCAGTACAGAGTATAAAGTTTTTAAAAATTGAAAAT
TAGTGATTGGGTTTAGAGTATGCACGGATGTTGTAAGGAATATTGTTTGGCAAAGTTTCA
CATAACGAGATATATGCTATTTTCAAACAAATAATCCTGCCAACACTAGCGATAATAGGA
GTTGTGGAAAGCTTGGACAATGTACATTTTACACACACATATACATACGCACAAACGGAT
GTACGTACAAATATTTCATTAACATAATATCTTATCCAGCACACCAGGCATATTAGGCCA
CCAAATTACGTATGGCTGTATTTCGGTTTGGCATTATAATTTTGAAAATTATCTCGCATT
ATGTGTGACTTCGCCGAATATTCACAAGCAGATCAAATGCTGGCTTTTTTTAGACATATC
AACCCCTAAATGGGTTTAGCGGATAACAAATATATATCAATAGTAATATAAGGTATATTC
AATAGAGAAGCTTTGACATCATAAAAGCTCCCATTTAACAAAAAATTATCTCCACATTGT
GATACCATTTAGAGTGGCACTCATCGCTATCTTTATCGTA
Chr coordinates Chr VII from 789031-790329
w3c xhtml validator w3c css validator