Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPC1
Systematic Name YGR149W
Strain S288c
Description Putative protein of unknown function; predicted to be an integal membrane protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPC1 YGR149W
TTCAACGTTGATTAATATAACGCCTTTATCGTGGGCCTCTTATTAACCTCAGCATTGTTC
AAATGGTCGCTTCTTTCTCAATTCCTACACTGCGAAGCTCCTCGTTGTCCTCAATATTCT
CTCATTTCCTAATGGGCACGCGACATACGTTTCAATTCAAATTGTTGCTCGCCTCTTTTG
TTGACCACCCAAAAATTTAAACGCCTATAATTTAGTTAATCAATATAGGTTACCTGTAAA
TATTGGTAATATCAACTCCCACTACTACTGTTTCTGGCTAGATGTCAACTGCGCAAGAGC
AATCAGGCCAAACGGGAACTCCCGTCAACCCATGGCTGGAGTTCCCTCAACGGGAACCTC
TACATTCTCCTACAGAGGCGCAGGCTCACGGTAAGGAACCCCCGGTAGTGTTGCGCGCTC
AACGACGCGAAAGCCTTAATTGCCGCAGTACAGAGTATAAAGTTTTTAAAAATTGAAAAT
TAGTGATTGGGTTTAGAGTATGCACGGATGTTGTAAGGAATATTGTTTGGCAAAGTTTCA
CATAACGAGATATATGCTATTTTCAAACAAATAATCCTGCCAACACTAGCGATAATAGGA
GTTGTGGAAAGCTTGGACAATGTACATTTTACACACACATATACATACGCACAAACGGAT
GTACGTACAAATATTTCATTAACATAATATCTTATCCAGCACACCAGGCATATTAGGCCA
CCAAATTACGTATGGCTGTATTTCGGTTTGGCATTATAATTTTGAAAATTATCTCGCATT
ATGTGTGACTTCGCCGAATATTCACAAGCAGATCAAATGCTGGCTTTTTTTAGACATATC
AACCCCTAAATGGGTTTAGCGGATAACAAATATATATCAATAGTAATATAAGGTATATTC
AATAGAGAAGCTTTGACATCATAAAAGCTCCCATTTAACAAAAAATTATCTCCACATTGT
GATACCATTTAGAGTGGCACTCATCGCTATCTTTATCGTA
Chr coordinates Chr VII from 789031-790329
w3c xhtml validator w3c css validator