Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGR153W
Systematic Name YGR153W
Alias TOS10
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGR153W YGR153W
ACCTCTATACCTTCTTCCACACTTATTACCCTTTCATTGATTAGATCAGCCTTGTTACCT
ATTAGAACCATTGGAACGCGATCGGAATCTTTGATCCTAAGGACCTGTTCTCTTAGCTCC
ATTAATTCTTCCAAAGATTGCCGATCTGTTACTGAATATACCAACAGGAACCCCATTCCT
GACTTTATGTATAATTCTCTCATTGCAGTAAATTGTGCTATACCCGCTGTATCTAAAATT
TCCAGGTCGAATACCTTGTTATCGATCTCGATGGTTTTCCTGTAAGAATCTTCGATCGTT
GGATCATACGTATCCAAATAAACTCCCTGTACAAACTGCACGGTTAAGCAGGATTTACCG
ACACCACCAGCACCCAATACTACTAATTTATAGTCTCTCATTAGTCCTAATGTTTCCTAG
CCAAATATTTCTAAGCGATGATAGAAGCCAAAATATTAGAACGTTGTATGTAAATGTTCT
ATATCGTTACTAAATAATAGTATTATTGTTCAGTGGAGAGGATGAAATTTCAAAAACTTC
TTGGCGTAGTTAAGAACGAACGCAATGGTTCTTTTTTTCGAGATCGAGCTCTACTTTACT
TTTTTCTTTTTCTGTCCTTCTCTCTTTTCTTTTTAACCTTTTTCGACGATATTTCGCGTT
TGAGAATGTCGAGGATGAATGCGCTTTGACGCGAATTAGTTGTGAGGCTGACGTTGTGAT
AAAAAGGCGATGATTCTTGGGAATATACAGTCTGTTTCCACTTGCTAGATAAAATGTATG
ATATTCCAAAAATGCCTTTCTCTATTGAACTGTATGACTGAGATACGCCTGCTTTTACCT
TGTATATTATGAGTACTATTCGCCTTTTCCCATAAAGTTGTTTTTTTCTGGGGTTTATGT
GTATCGTAAATGGTACAAAATAATAAAATTCTTATCTTGAAAATACTGTTTAATACTTTT
CATCATTACTAAATAGGTTACGAAAAGAGGTCTTTGAGAA
Chr coordinates Chr VII from 796092-796745
w3c xhtml validator w3c css validator