Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HGH1
Systematic Name YGR187C
Strain S288c
Description Nonessential protein of unknown function; predicted to be involved in ribosome biogenesis; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm; similar to mammalian BRP16 (Brain protein 16)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HGH1 YGR187C
CTGGGAAATGCGTGCGGGCAAGCCATGGAGTTATGAAGCGGATTATTATGGATTAGCAGG
CGTCATACATTCGATGCTTTTTGGAAAATTCATAGAAACAATCCAGCTGCAGAATGGACG
ATGCAAATTGAAGAACCCATTCAAAAGGTATTGGAAAAAAGAAATATGGGGCGTTATATT
TGATTTACTGTTAAATAGCGGTCAAGCTTCCAATCAAGCTTTGCCGATGACTGAAAAGAT
TGTTGAAATAAGGAATTTGATAGAAAGCCATCTGGAACAGCACGCAGAAAATCACTTAAG
AAACGTAATTCTAAGCATTGAAGAGGAGTTATCACATTTTCAATATAAGGGGAAACCGTC
AAGGAGATTTTAGTGAATAAATATGCCTTCATCTCCCGCATAGGTGACTTTTTGGTGTCC
TGCCAGATTCCATAGCAATGACAACACAACTTCAGGTAGAGCCAATTGTAACATTAATAT
ATAAAAGGTAATATAAAACTAGCAGGTTCTCAGGTTGAGTAAATATATTCTTTTTTAATC
TTGACATCTGTCACTTATGGAAAAACAAGTACCAAAAAAATGGCGATAATGTTATGATAT
TATTTTACTGAAGCTCTTCATACATCGAGTATGTAGCAATTGCTCCACTTGTTACCGCGA
AAACTAACAAGAATAAAAAATAGATGTCTTGATTCGCAATTCGCAGTATATTTCATCTAA
TAGCTGCAGAGCCAATTGGGATGTTACTGGTAGTGCTACCTTTCGATGTGTTCTGTTATC
ACCCCAGACGATAATTATTATTGTAGATTTTTCCCTATTCTTCCTCGAAGGGCTTTTTCA
AATTTTTTTTTTTTTCATTTTTTCATATTGAGCTCTCTCATCTCATCCATCAATTTATGA
CGCACCTACTCTAATAACGACAAGTTTATTCTTCTTAAAACGGTATCAATTTAATTTAAA
AATTAAAAATAGCTCAAAAAAATCAACAAAAAATTGAGTG
Chr coordinates Chr VII from 871416-870232
w3c xhtml validator w3c css validator