Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPI1
Systematic Name YGR216C
Strain S288c
Description Membrane protein involved in the synthesis of N-acetylglucosaminyl phosphatidylinositol (GlcNAc-PI), the first intermediate in the synthesis of glycosylphosphatidylinositol (GPI) anchors; human and mouse GPI1p are functional homologs
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPI1 YGR216C
TGCGCGGGTTCGGGTGTTAGATGAATTGATCCTGGAGTAGCGCTTGCTCCTACATTGGGT
GTATGAACGTCAGGTATAGATTCTTGTTCTCCTTCTCCTCTATCTTCTCCAACGTCTGAT
ACAGGACGGCTTTTTTCTGATTTTAATTGGGGTAGCCATGTCAGGCCCTCTTCGTCTATT
GCACTTTTAAATCCCTTTTGCAAATCTTCAAAATCATCCATATCATCAGCGGCAATTAGC
GATAAAACCTTTGCCGACCGTGGAGGCCTATCCGTTGAGCTTGGTGAATTAGAAACACGC
CTACTAGATGATCGGCTATAACTACTGAAGCTACGCCTGCGTAGCCTTTCATCATTTAAA
TCAATATACTGCGAACTAGACTTGGCAGATTTTGTAGAGGGTGAAACATTACGCCGGGAA
GATTCAGCGGCACCAAATGATGCTGTTTTAAGTGAGAGTTTAGGCCTGCTCAAGTTTTCA
TGACTACTCCTTCCGACACGAGTACGAAATATGTTGGAGATTAAGGAGCTATCTTTATCA
TTTCCATTGTACTCGTCACCTTTTTTTTCTTCAGTACTGTGGATGCTGCTCTCTGGTGGC
ACGATATTTAAAGCTGGTGGGACCAAAGCTTGTGGTTTTGATTCTAGACGGTTACCATCT
GTTTCGCTGTTATCCTCAACATTTTCCGTCATTACTGCTGCATTGTCCCCAAATGGATTG
GTATTTGGCTCAAATGGTTCCGTAAGCGTCCTTTTTCTCCCCTGCATAGTACTAACAATA
TATTCTATTTAGTAATGCCGTGTATTTTGATTTTCCTTATGTTAGCTTGTCACCAACCAT
TGATTCATGATCTTCTATCTCATCTATATTTATTTTCAGTGAGAATGCCGAAATGTAGAA
TATGAAAAAAACCTACCAGAACATAATACCAAAAAGAATGAAAATTCCTCTGTGAACAGG
AACCTTCGAATTCAGGGGCGGTTTTATACAGTTAAATGAC
Chr coordinates Chr VII from 924462-922633
w3c xhtml validator w3c css validator