Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HUA1
Systematic Name YGR268C
Strain S288c
Description Cytoplasmic protein containing a zinc finger domain with sequence similarity to that of Type I J-proteins; computational analysis of large-scale protein-protein interaction data suggests a possible role in actin patch assembly
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HUA1 YGR268C
GGTGATACAAGATCAACATCATCGTCTTCATCATCGCCTTTCTGGTTGTTGTTATGATGT
TCATCACTAGTAACATCAACGGGCGTCTCATCTTTGTCCATGACCTGGTCATCTTCCAAA
AAATCAAACACTTTCTCAATTTCTGCGTAGTTTATTTTTCTCAAAGAGCGAGTTGTTGTA
TGGATTATGCCATTTTCGTCTTTAATCTGTGTTTCATACCCAACCTTTGCGTTGCTTGCA
TCTTCAACGTCGCTACCGCGTCTATTCCTTAAATTTCGTGCCATGTTCTTTCTGCACCAA
TTGTGAATAAATAGCGAGAAGAGAGAAATAGACCGTGGTAACTTCTTTTTATGACTGTCG
AAAACAACAATGGGTTAGTAAGGAGTACGCAAGATCCTTCAGACGTTTTGCTTTATTTAA
GACCCTACGCAGTTCCTTTTCTGCTCCTTTTCGTCCCAATATTGCTCTTTCGCTACCACT
TTGTCCTTTTTCGCACACATGGCCGTACAAAATAACAGACGGTACGTTTTTAGTGATAAT
AAACAAGTTTATAGAGGCAGAAAAAAATTCCTCAGCGGCTAATGCCTCAACAAGTTCAGC
TGCAAACGATGAAAAGACGCACACAAAAGCGAATAGAAATAACCGATCACCACAGTTCCT
CTTTAAAACATCTCAAACTCAGCATTAACTTTCAAATCAATCCAGTGAAAGTATGCTTGG
TTTGACACTTCACTGCCATTTCCTCCTGCCTGCCTATCTGATGCTTTGCCACCACAAGAG
TGTTTTCCCTATGGCTTAATCGCTTTTTTCCATTTATTTTTCTCTTTCCCCCTTTTAATA
GAGGGAAGAGAGCAGAACATACAAACATATCATTTTCTACGGTATAGCCTCCGCCTCCAT
CTTTAATAGTGACACTTCCATCAAGGGAATAAAGAGGCTTCAAGTCAAGAACTAAGCAGT
CCCAAAAAATACCCATAAAACGAGTATAAACCATACTGTT
Chr coordinates Chr VII from 1026653-1026057
w3c xhtml validator w3c css validator