Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PAU12
Systematic Name YGR294W
Strain S288c
Description Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PAU12 YGR294W
AGAAAAACACATGACCAGAATGATAGACATATTGAAACAGTGAATAAAAGGGAGAAAAAG
GCTTAAAGGATTTCTGTATTAGTAACACTAAGCCCTCTATCAATTTCATCCAAACAGAAA
GACTGCAGGTACATCCATAGGATAGAAGTTCTGTATGTAATCCGCCACTTTTTGTCTCCT
TCATGTACCATATAATGAATAGAAAAACGTAGACCTAGGCGGCAACCGTTGCCTACCATA
CGAAGCGCTGATGCTGTTCTCCGATTATTAGTATTACAAAAAAAATTATACAATACTTAT
TAAGATGTTAACTTATCAATTTCCGGTATAGTTTCCGCTATGGTCAGCTTTGTCCAGTGG
AAGTTCCGCTGTTTCAGAACTAGAGCTTCGTAGCACCTCGAATGCTCATTTATTCTTGTC
AACATTTTTGCTGGCAGTGTATAAGACTGTAGACACCTACAATATACGACTCCGGTATTC
GATAAGTCTTTCACTTTCTATTTTAAGAAAAACAGAATCTACAATTTTCCCGTAGCAACC
GTTTAGCGCACAAAGATTAGATGGCCTCTGAACGAGGGTTCAAAGCAAATTTGGTTTTAG
CTTTTTCTTGGCCAAAAGCTGCAGCTGCATCTCTGAAGGCACCCTAAAGGGATTCTTCGG
AAGTATGTACACTGTGAGAAAACATTCTTGTGCCTTGGAAATGCAATAAAAAGGTATAGG
CACTATGAAGCGTGCGCCTCGTATACGGGACCTATGAAAGACGCATCGTTCAAGTACAGA
AGCACCGTAATAATATGAATAATGAATGTGGGATGAACATTGTACACTGAGGCATTTTAG
GTGAGAGATGGGTGCCAGATGATAACTCGTTTGTGCCAGGGAAGTTGGCAAGACATTCAT
ATAAATAGAGCTGCTGTAGCTATCCATCTTTGAGGTATGCGCTTTCATTTCACTATTTCT
TGTTAAGCTTACATCAGCACTAAAAAACAAAACAAATACA
Chr coordinates Chr VII from 1080306-1080668
w3c xhtml validator w3c css validator