Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AAP1
Systematic Name YHR047C
Alias AAP1'
Strain S288c
Description Arginine/alanine aminopeptidase, overproduction stimulates glycogen accumulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AAP1 YHR047C
CCAGCTTTAATAACAACATCAGTAATATTACGTTATTGGATCTTCCACTCCGGTTCGAGG
AAAAAAAGAGAGGAGGAGAAACGCATAAGCTACAATAATGAGTGAGTTAACGCTTTAATT
TGCTCAGTGATCATTGCTAGCCGGATATTTGTGTTTTTGTAGAACCCAGCCATACCTAAT
CATCTCAGTATATTATCTGAATTCTTGACTCAAAATATGGATTTTCTCGAACGTCTCACT
TCCAATCATCCCATCAAATGCTGTGGATGAAAACATTTAAAACACGGGCAAGAAAAAATG
AGTATAGTATAGTTGTGGCCAGTTCTTGTTGTACTAATGCACTTGCTTTCGTATCAAAGT
TGAAGAAGCACTGAAAGAACAACAAAAAATTTATTAAAAGCAAAAATCATTCTACGTTCA
ACGAAAATGTAAGGCAAATATATCTTTATATAGGCAAGCATAACCGACGCTAACTTTGTT
CGAGCTTCATCAACGTTATTAATATCGTAGTTATTCCGCTTTGTCTCAATAAGCTTTTGC
TTACTTGAGAAAAAGAACGAAGTTTCTGTTTGAGATTTTCCTTCTCATTTTCTTTGAAAT
TTAAAGGAGAAATATTCAGCTCTATACATTCTTTGTTCGAGTATGTTACACATCACCTTA
CAATGGGAACATCCTATGATGACATACTTCTTCTCGATGATTTATTTTTTTTCTCAGCAA
ACGCTGTTTTCTAGGCGGTGAAAAACGGGAGTCTTCATCCCACATTTTTTGAACTCGTTG
TGAAAGTTTTTTTTCGTACTCTTGGACTTGGCTGTGGGAGTTTGACACATTTTTTTATTT
TTTTTCCGTTTTTTTCCCTTTTGTTAGCGATCAAACTTTTGACTTTATGAGTAATCTTAG
CTAATCATTTAGAATTATCTTCAGGGAAGCTTATTCAATTCGTGATTTTTCTTTGAGGGT
TCCTGTTCAAGCAAGCCAAATTGCCCTCTCAGCTAATACC
Chr coordinates Chr VIII from 201310-198740
w3c xhtml validator w3c css validator