Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DYS1
Systematic Name YHR068W
Strain S288c
Description Deoxyhypusine synthase; catalyzes formation of deoxyhypusine, the first step in hypusine biosynthesis; triggers posttranslational hypusination of translation elongation factor eIF-5A and regulates its intracellular levels; tetrameric; human homolog DHPS allows growth of yeast haploid dys1 null mutant after sporulation of heterozygous diploid
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DYS1 YHR068W
GAGATGGTTATTTTAACTATCAAAATCCTGCAAGTTTGCTAGGAAACCCTGATTTACGCT
ACCGTAGAAGGATTTGGGGACAAGGAGAGCTTGTTCAGTATTTACCAGTCACCTTAGACC
AGGAGTATACATGCCACGAATCAATCAAATACGTAAAAAAAATACGAGATGAACATGTTG
TCTGTATTGAAAGAACCCTTTTACAAGAAAGGCCCGAAAATGTGTCGAGTCCAATGGACA
TTTGCTTATTCGAGAGAAGGGTATTAATGTACACCAATTCACCCGCAAACAAGACTGCAG
TCAAGATGCCCGTAGGAGAGGAGAACTATAAGATCTTAAAAAATTTTACTGTTACTGATA
TGGATATTGTAGCTTATGGTCAGATGTCTTTGAATCCGCACCGAATTCATTGGGACAAAG
AGTACAGTCGCTATGTTGAAGGCTACGACGATATTATCATGCAAGGACCCTTCTCGGTCC
AATTACTACAGAAATGCATCCAACCTTTTCTCGAACAACCAATCAGACAGTTGCGATACC
GCAATTTGAATTATATATATCCAAACACTACTTTGAGCATATGTCAGTCTTTAAGCTCTT
CGAGCGGAATGTACACATTTCAAATTAGGGACCTCCAGAAAGCCAACTTAGTCTACATGA
AAGCTGATGTTTTCTGTTGACTACCAGTAATTGTCTCTCTGCAGATAATCACTACCTGTG
TGTTTCTTGTCTCTTGAAATAATACTAGTAGCTGCTGAACAGTGGAAGGTCACGAACGAG
ATTACCATAATATCTCGCCATCACCAGGTTGACGGTAAACGCATTACGGGAAGAACTGAA
AAAAAGGTGGGAAAAAAAAATAAAAAGTAAAGTGAAAAATTAAATGTAATGTATATTTCC
ATTTTGACGCAAAGTACTTCCCTCTATCAGTTTTGTATCTAACTGCAGAGTAAAGTCGTG
TTTTGCTTAGTTAACTTATATACAAGTCAAAGCAAAAAAG
Chr coordinates Chr VIII from 232133-233296
w3c xhtml validator w3c css validator