Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DYS1
Systematic Name YHR068W
Strain S288c
Description Deoxyhypusine synthase, catalyzes formation of deoxyhypusine, the first step in hypusine biosynthesis; triggers posttranslational hypusination of translation elongation factor eIF-5A and regulates its intracellular levels; tetrameric
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DYS1 YHR068W
GAGATGGTTATTTTAACTATCAAAATCCTGCAAGTTTGCTAGGAAACCCTGATTTACGCT
ACCGTAGAAGGATTTGGGGACAAGGAGAGCTTGTTCAGTATTTACCAGTCACCTTAGACC
AGGAGTATACATGCCACGAATCAATCAAATACGTAAAAAAAATACGAGATGAACATGTTG
TCTGTATTGAAAGAACCCTTTTACAAGAAAGGCCCGAAAATGTGTCGAGTCCAATGGACA
TTTGCTTATTCGAGAGAAGGGTATTAATGTACACCAATTCACCCGCAAACAAGACTGCAG
TCAAGATGCCCGTAGGAGAGGAGAACTATAAGATCTTAAAAAATTTTACTGTTACTGATA
TGGATATTGTAGCTTATGGTCAGATGTCTTTGAATCCGCACCGAATTCATTGGGACAAAG
AGTACAGTCGCTATGTTGAAGGCTACGACGATATTATCATGCAAGGACCCTTCTCGGTCC
AATTACTACAGAAATGCATCCAACCTTTTCTCGAACAACCAATCAGACAGTTGCGATACC
GCAATTTGAATTATATATATCCAAACACTACTTTGAGCATATGTCAGTCTTTAAGCTCTT
CGAGCGGAATGTACACATTTCAAATTAGGGACCTCCAGAAAGCCAACTTAGTCTACATGA
AAGCTGATGTTTTCTGTTGACTACCAGTAATTGTCTCTCTGCAGATAATCACTACCTGTG
TGTTTCTTGTCTCTTGAAATAATACTAGTAGCTGCTGAACAGTGGAAGGTCACGAACGAG
ATTACCATAATATCTCGCCATCACCAGGTTGACGGTAAACGCATTACGGGAAGAACTGAA
AAAAAGGTGGGAAAAAAAAATAAAAAGTAAAGTGAAAAATTAAATGTAATGTATATTTCC
ATTTTGACGCAAAGTACTTCCCTCTATCAGTTTTGTATCTAACTGCAGAGTAAAGTCGTG
TTTTGCTTAGTTAACTTATATACAAGTCAAAGCAAAAAAG
Chr coordinates Chr VIII from 232133-233296
w3c xhtml validator w3c css validator