Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IRE1
Systematic Name YHR079C
Alias ERN1
Strain S288c
Description Serine-threonine kinase and endoribonuclease; transmembrane protein that mediates the unfolded protein response (UPR) by regulating Hac1p synthesis through HAC1 mRNA splicing; Kar2p binds inactive Ire1p and releases from it upon ER stress
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IRE1 YHR079C
GTCTTATCCTTGCCATAAACAGAAGACAACTTGCAAGTATGAACTATTTGGAAACACAGT
TAAATAAAAAGCAAAAACAGATACAGGAATACGAAAGTATGAATGGCAACCTGATAAAGA
TGTTTGAGCAATTGTCTAAAGAAAAGAAAAAGTATGTAGCTATTTTTTCCAGTCGGCAAA
AATCGGTATAACAAACAAAAAATATTTAGTTTCTGTTATTAACAGAACTTGTCAAAGTGA
TGAGACACCAAAAAAAATTTCCTCGACGTACATTAAAGAGTTAAAGGAGTACAACGAATT
GAGAGATGCCGGTTTAAGGTTGGCCCAAATAATTGCTGATGAAAAGCAATGCAAAATTAA
GGATGTTTTTGAAGAGATCGGTTATTCAATGAAGGACTAATGGGCTTTTAGGGACAGTTC
TATTCTTCCAACGTGCGAAGCGTTCCAATGAAACTCTGCTGCGCGCTGAAAACTATATAA
AAAAAAAAAAAGATAAAATTACAAAGAAGTAATGAACTTAAATGCTATTATACAGTTACT
AATTAAGCTGCGTAGTGTGAAATATATTGATAGTTGTAGTTTTGAGGTTTTATTACCCTC
TGTTATATAATAGGTTTTCGCTATTTTATTGCCGAAAATCAAGACGGAGCGTAAGCCTCT
TCGGGCAATACCTTCGACTATTCCAACAATAAAATTTAAAAAAAGAGATTAATCACATAG
TAACAAGAAATAAACGAAAAACATATCATAGGAGATCAATGAGCCAACTTCACATAAACT
AACAGTGAAAAGTCTATAACAATATTAATTTTACACAATTAAATCTACACTATAACTGGC
ACTGTTAATAATCGGTAATCTGCTAAGTAACTTTTTTTTCTCATTCACAAAGCATCGTTT
TCCTCTTCCCCACGTCCATTATCACTTTTCTCCATATCACCCTTCATACACATTAAAAAA
ACAGCATATCTGAGGAATTAATATTTTAGCACTTTGAAAA
Chr coordinates Chr VIII from 261591-258244
w3c xhtml validator w3c css validator