Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IPI1
Systematic Name YHR085W
Strain S288c
Description Essential component of the Rix1 complex (with Rix1p and Ipi3p) that is required for processing of ITS2 sequences from 35S pre-rRNA; Rix1 complex associates with Mdn1p in pre-60S ribosomal particles
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IPI1 YHR085W
ACACCAGGTTCCGCGATGTTCCCATACATGCAAAGTTCAAATTCCATGCAGTGGAACACT
GCTGTTTCACCTTATAGTTCGAGAGCACCATCTACAACTGCTAAAAACTATCCTCCTAGC
ACATTTTATTCTCAAAATATAAATCAATACCCACGGCGAAGAACTGTGGGAATGAAGTCT
TCACAAGGAAATGTTCCAACAGGTAATAAACAATCTGTGGGCAAGTCTGCAAAAATTTCA
AAGCCTCTACATATTAAGACAAGTGCTTATCAGAAGCAATACAAAATCAACTTGGAAACG
AAAGCCAGGCCAAGTGCTGGTGACGAAGATTCTGCTCATCCTGATAAGAACAAAGAAATT
TCGATGCCTACTCCGGATTCCAATACTTTGGTGGTCCAGTCAGAAGAAGGTGGAGCTCAT
TCACTTGAGGTAGATACCAATCGAAGGTCCGATAAAAACCTTCCAGATGCAACCTGATAT
AATATAATTTTTGAATTTATGATACAAGAATTAAAAATGCGGGCCAGAATTTAATATTAA
ACAATACTCAGAAGAAAACAACAAGGACAATCTGTTTTTATAAATAAAACAATCTTATAC
AAGACTAGAGCAAACAAAAAGCAAGAAAAAAAGGTAATAAATGTAACAAATCTATTAACG
TTAGAAAATAACAAAAAAAAAAAAAGAAAAAGATAATATAATATAATACCTTTATATATG
TGATTTATCTAGCGTCACAGTATGTAATATAAATATCAATGAGTTTCTTAACATGACCTC
CAAAACTACATGATCGCTTAGTATTACAATATGTGTTTATCCACTATTTTGATACCAACG
TAGTATTGCCTTTTATTTTTCAGAATGGCAAAGGCCATCGGAAAATTTTTCCACCAGAAA
AAGCGAGATTCCTAATTATAAGGTGAAGGCATCGATGTTCATAATAGTTAAAAGTTGTAA
TCAAAAAAGAAAAAGGTGCAGAGATAAACAAAGTTAATAA
Chr coordinates Chr VIII from 276764-277768
w3c xhtml validator w3c css validator