Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNG2
Systematic Name YHR090C
Alias EAF4, NBN1
Strain S288c
Description Subunit of the NuA4 histone acetyltransferase complex that acetylates histone H4 and H2A; has similarity to the human tumor suppressor ING1 and its isoforms ING4 and ING5
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNG2 YHR090C
GTACTTGACAAGAGATGTAGGGGCAGCCATAGAGCGTAAAAAGAATCTACATTTTGATAA
AATGGTGTACGTGATTTCCTCACAGCAAGATTTATACATGTCCCAGTTTTTTATGATATT
AAAAAAAATGAATTTTGAATGGGCAAAAGACTTGCAGCATATAAATTTTGGTATGGTGCA
GGGCATGTCGACCAGAAAAGGAAATGTGGTATTCTTAGATACCATACTAGACGAGGCAAG
GGATAAAGCTCTGCAAATTATGGAAAATAACAAAATGAAAATATCTCAGGTAGATAATCC
ACAGCGTGTTGCAGATTTAATTGGCGTATCTGCTATCATTATTCAAGATATGAAATCAAA
GCGTATCAATAACTATGAATTCAACTGGAACAGAATGTTGTCTTTCGAAGGTGACACAGG
GCCCTATTTACAATACACACATTCCAGACTTAGATCTTTAGAAAGGACCTCCAGCGACTT
TACGACGGACATGCTAATACACGCAGATTTTTCAAATTTAAATGAACCACAACTAGTTGA
GCTTGTGAGGTTGCTAGCGCAGTATCCAGATGTCCTTAGACGAGCATTCGAAACTCAAGA
GCCGGCCACGATTGTAACATATTTATTCAAAGTTTGCCATCAGGTCTCCTCGTGCTATAA
AAAAATATGGGTTTCCGGAAAACCTGCAGATATTGCCATACCGCGACTCGCCGTATATTC
AGCAAGTAGACAAGTGTTACACAATGCAATGTCGCTTTTGGGACTAGTCCCGGTTGATAG
AATGTAATTATATGAATAAGCTAGCAAATGCTAGATTAATTTAGATTAAGTTTAACCAAT
TTATAAACATGTAAATAGAAGAAAGTTTATTGTTACGTACAACGTGATATTTTCCGATTT
TCCTTTAATTGATTCTTGAATAACCCACCTACCGTTAGTTGAAATAGAAACAAAGAAGAA
GGATATGCAAGTTTATATTGGACAACATAACCAATAGAAG
Chr coordinates Chr VIII from 284625-283777
w3c xhtml validator w3c css validator