Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SET1
Systematic Name YHR119W
Alias KMT2, YTX1
Strain S288c
Description Histone methyltransferase, subunit of the COMPASS (Set1C) complex; COMPASS methylates histone H3K4; Set1p-dependent H3K4 trimethylation recruits Nrd1p, allowing efficient termination of snoRNAs and cryptic unstable transcripts (CUTs) by Nrd1p-Nab3p-Sen1p pathway; modulates histone acetylation levels in promoter proximal regions to ensure efficient Nrd1p-dependent termination; required in transcriptional silencing near telomeres and at silent mating type loci; has a SET domain
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SET1 YHR119W
CGTTTCCTGGTTCCTCTTCATCCTCATCCTCATCCTCTTCAAATGCTAACTTTCTCCTAG
TAATAGACGGCGATTCATTGGTTTGCATGGGGGGTAGTTCTGGTATTACGAACGAATCAT
TATTTTGGCTTTTCCTAACTTTAGTTGGTGTACCAAACAGTTGATTCCTCAACTCTTTCG
GATCAGAAGAAGTAAACCTCCCACCGTTCTTTACTGGACTGCGTTTGTTCTTTTTGGGGC
TCGGTGTCCAAGCAAATTGTTTCATAGGTGAAGAATTAGATAAACTTTGTCTGAAAAGGT
TCATTAAATGCTTGGCTTTTTTCGGCTCCAAGGGAATACTGTCTATATAATAGCAAAGGT
CAGGCATGTGTTTTTCATTCATTTTCTGTGACGCTATGTATGCACATATGTGACATCTAG
CAACCTCTTCATCTTGTTTCAGCATTACCTTGTTCAGTGAAGTATTATATAAAATCGATG
TCGCATTAGTCAACTTCTTCAAATATCCGCTCGACCAGTCCGGTTTTTCTTGTGGATCTA
GTCGAAGTACTTCTGCGACACAATGTTGGACTTGTTGCATGGACATGACTGGTTTTAATG
GTATTGTTTTGGCCAATTTTATTTACTGATATTGTACACTTTTTTCTGCAATTTTAGTGT
GAGATTTTTTTTTTCAATGCCGATTTCTTACTAACGTAAACAACGGCAAAGAACAAAGAA
ATACACAGTTTTATCACAAAGAGTTGATTTTTGCTGAAGAGAAGCGTGAGGAGTGTATTC
GAAAGCCTTGCATATTCTGGACACTTGCGATTCTAGCTCTTTACGGACGCCCGCATTCTT
TTTTCATACTCTGTTTCGTGCTGCTTTCACACAATATTTTTCAAAAGTTTCTTCTCATCG
TTTTTCTGTTAGCAACCCTCAACTTACGAGAGAGTTGCGACTAGCATAGGTAACATTCCT
TATTTGTTGAATCTTTATAAGAGGTCTCTGCGTTTAGAGA
Chr coordinates Chr VIII from 346043-349285
w3c xhtml validator w3c css validator