Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MTC6
Systematic Name YHR151C
Strain S288c
Description Protein of unknown function; mtc6 is synthetically sick with cdc13-1
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MTC6 YHR151C
ACATCTTAACTTTGTGCTCATTCAATTTCAATGAGCATGGTGATACCAGCCTGTCAGTCG
GTGATGCAAATCTTTGTTGTAGTTGGAGTTTCCTCTTCGGATCCTGTTTTAAAAGATCCC
TTTTGAACATTGTCTTTTTTACCAAATTGCTAGTGGTGTGTGACGACTTCAAGTTTGAAG
TGCTTTTTTTCCTAAAAATTCGAAAGGCCGCAATCTCCTCCTCTAAATTAGGTATATTCT
CTTTATTGGCGTCCTCTCCTGTCTTCGCCGATTCATTGTAATTATTGATGTTATTGTGGT
GATGGTAGTTGTCGTTGTTGCTGCTGCTGCTTCTGGTGATTGTGTTTTCTCTGGTAATAT
CAGTCTTGAGGATGGAAGCCGTGCGTGCTGATTGGTCACTTGCCTTGTTGGACATAAATA
CGTTTTCTATTGTTCTTACTGTATATGTTATTTTGTTTTCCTACTAGAAGTATTCCAAGA
TAGTAACTAATCTGAATGAACGTTTGGCTGACCTCCTAAAAACTAGTTTGAAATGGCGCT
TTAGACTTCAAAAGGAGGAATTCTCCTCTTGTGGCAGTATTGTTTCATGCTTTTGCTTAC
AATTTTCATTAGGAGAAAAAAAGGAAAGATGCCCTGTTTACATATTTCCAAATTAGGAAA
AGATATTAACCATGGCGAACTGCATTTCAGACCTGCTTTTTTTTTTCTGTAACCCTTTTA
AATTAGGGTTTGCAATTTTGGCATTTTTCTTTTTTCCACAATGGGAAGAGGCAATACAAT
GGGAATCATTGAAATTTCCATAAATGTTGATGAGTCTTTGGCTGAGCAAGTCACATTGAA
GTGTTCGCTGCACGGTGAGATACACCCTGTTTAACTTTATTTGTCACCTTTTTGCTGGTA
TTTTTTAGTCGCTTTTAACCTCGCTTTTTCAAAGACTATCTCCATTCTATTCTTCCCTTT
TTCTTTTGTTCATTTGCATTCGCATCGTTATAGACACGGT
Chr coordinates Chr VIII from 400848-399268
w3c xhtml validator w3c css validator