Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MTG2
Systematic Name YHR168W
Strain S288c
Description Putative GTPase, member of the Obg family; peripheral protein of the mitochondrial inner membrane that associates with the large ribosomal subunit; required for mitochondrial translation, possibly via a role in ribosome assembly
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MTG2 YHR168W
TCTCTGCGAGGAGGAACAAAGTTTGCAGGAAAGCCAAACCCACTTATTAAATATTTTAGA
TATATTATCAGTATTGGCAGACCCTAGATCATCTGATGATCTGCTTACTGAATCCCTCAA
GAAGTTGCCTGATTTACACAGGGAGCTGATAAATAGTTCCATCCGCCTGCGATACGATAA
ATATCAAACAAGAGAAGCACAGCTTTTGGAGGATACAAAAACTGGAAGGGACGTTGCAGC
GGGAGTACAGAATCCTAAGAGTATTAGCGAGTACTATTCTACTTTCGAACATTTGAATAG
GGATACTTTAAGGTACATAAATTTACTGAAGCGACTTTCTGTTGATTTAGCAAAGCAGGT
GGAAGTGTCTGATCCATCAGTGACAGTGTATGAAATGGATAAATGGGTTCCATCTGAGAA
ACTTCAGGGTATTCTCGAGCAGTACTGTGCGCCTGATACTGATATACGTGGTGTAGACGC
TCAAATCAAGAACTATCTAGATCAGATCAAAATGGCACGTGCCAAATTTGGTTTAGAGAA
TAAGTATTCCTTAAAGGAAAGACTCTCTACTTTGACAAAGGAACTAAACCATTGGCGAAA
AGAATGGGACGATATAGAAATGCTTATGTTCGGTGATGATGCACATTCTATGAAAAAAAT
GATCCAGAAGATAGATTCATTAAAGTCTGAAATAAATGCTCCATCGGAAAGCTATCCTGT
AGATAAAGAAGGTGACATAGTTTTAGAATAAGCACATTTTATTTAACCAGCCTGCACAAG
TTAGATAGAGTTATACATACTTGTTGAGTGGGAGGGAAGAAAGAGAAAAATTGTATTATT
TTTTAAAGAGCTTTTTAATATTTTATTTGTTCTATCTATTATTTTCACTTCCCCGAAATA
GTACTGAAGGAAAAAACATGCTGGTTTATTTAGCGTTTAATAGGATGTGTACGTACTGAG
AATATCATCAAGAATCAGTCCTCGGCCAGAGCATCTAGAT
Chr coordinates Chr VIII from 440377-441933
w3c xhtml validator w3c css validator