Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPC97
Systematic Name YHR172W
Strain S288c
Description Component of the microtubule-nucleating Tub4p (gamma-tubulin) complex; interacts with Spc110p at the spindle pole body (SPB) inner plaque and with Spc72p at the SPB outer plaque
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPC97 YHR172W
ATTAGGGGATATACCTCATCAAATACGTGGGTTTTTGCATAATTTTTCCATCTTAAAATT
AGAAACTCCAGCCTATGAGCATTGTCCAGCATGTAGCCCTAAAGTTATCGAAGCATTTAC
AGACTTAGGTTGGGAATTTGTTAAAAAGGCCTTGGAGCATCCACTTTACCTTGAAGAAAT
TAGCGGTTTGTCAGTCATAAAGCAGGAGGTCGAACGACTAGGCAACGATGTTTTTGAATG
GGAAGATGATGAATCTGATGAGATTGCTTAATATTTTGCATATAATAGCATTGGTACATA
TTGTGGTGCCACTTTCCGTAATTAAGCTACTAAATTTTTGACTCTAACGTTTATAACATT
GAATTATTAAAATGATCTTGCTATACTATTTTGCATACATTATTTTTTGTAGTTTTAACA
AGAAGACAAATTCTTGACTTTACTCACAAAACATAAACATAAAATGTAATAAAGTCCTCA
ATGTTCACCGTATTTTTCAAAAAGGATCAGTGAAAGTGTCGGTAAAGCTACCTTTTTGAT
ACTTTCTTTTTATGAGAATAAGTTGTATTTCTTTATTATGTATGATACGGGCGTTCAATC
AATACGTTTTAAGTTCGTTGCTGACGGCTAAGAAATTGGTAAGAGGAGTAGTTCCATCAA
TGTCTAAAGTGATATGATAAAAACTATACGATTTGAAGATCTATGCGTTCACTTCACGTA
TCCAAGTTTCCCCTCCTAATAATTCACATTAATTTGGCATTCATATCTAAAGCGTTGCTA
TTACCCTTCCCCTGGTAGTCGCGGAACAACAAAAAACGCCAAAATAAGTAATGAAAATGT
AAACAAAAAGGAACTAAGTTGAAAAGTCATCGAAAGCGATACCACCTGGTTCTTTCTTCA
TTATAGACTAATTGTTGCGTGCCAAGAAGTTGTTTGTGTATCCATAATATTTATTATCAA
ACTGATCTAAGATTGCTTTGTACACATCTTGCGTGAAAAA
Chr coordinates Chr VIII from 448335-450806
w3c xhtml validator w3c css validator